Pectis multiflosculosa — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pectis

At a glance

Occurrence records419

Data sources8

Biological traits11

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Pectis multiflosculosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility419 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF419 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 72

01Narrative

Pectis multiflosculosa là một loài thực vật có hoa trong họ Cúc. Loài này được (DC.) Sch.Bip. mô tả khoa học đầu tiên năm 1856.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formsemisucculent subshrub

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pectis multiflosculosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ524969.1 ↗687 bpCosta Rica

ACGT

TAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCTACCATGACAACATGCGAACTTGTATCAATAACGTGGCTTTACGGGGGAAGAT …

Pectis multiflosculosa voucher William Haber 9243 clone 2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS2ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pectis multiflosculosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 361×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Keil, D. J. 1977. Chromosome studies in North and Central American species of Pectis L. (Compositae: Tageteae). Rhodora 79(817): 79–94.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type419 records

Wild obs. + sensor104

Museum / vouchered315

Origin

Native1

Range

Area of Occupancy AOO964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 44≤1 km 14≤10 km 3>10 km 4

65 georeferenced · 39 without coordinates

Open the mapobservation + sensor104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 125≤1 km 6≤10 km 19>10 km 6

156 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence315

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	61
Austin, US	38
Saint Louis, US	25
Zapopan, MX	23
Durango, MX	19
National Biodiversity Institute, Costa Ricalocation not on record	18
University of Stellenboschlocation not on record	14
Bronx, US	12
Ciudad de México, MX	12
Xiamen, CN	10
Riverside, US	8
Stockholm, SE	8
Museo Nacional de Costa Rica (MNCR)location not on record	7
Austin, US	6
ASUlocation not on record	5
Culiacán, MX	5
Kew, GB	4
Antiguo Cuscatlán, SV	4
León, NI	4
Tapachula, MX	3
Aarhus, DK	3
Mazatlán, MX	3
San Luis Potosí, MX	2
Berlin, DE	2
San José, CR	2
BAYLUlocation not on record	2
CASlocation not on record	1
Salamanca, ES	1
Tuxtla Gutiérrez, MX	1
Wuzhou, CN	1
EL PASO, US	1
Wlocation not on record	1
South Kensington, GB	1
Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record	1
Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record	1

35 institutions · 309 of 315 vouchered records shown · 6 without an institution code

09Environmental DNA2 detections

Where the DNA of Pectis multiflosculosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 20.6–20.6

Seasonal swing summer↔winter1.70 °C

Max temp (day)24.6 °C

Min temp (night)17.4 °C

Precipitation253 mm/mo

Air humidity71.2 %

Moisture balance125 mm/mo

Vapour deficit699 Pa

Wind speed1.70 m/s

Cloud cover31.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.