Pectis imberbis

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pectis

At a glance

Occurrence records21

Data sources12

Biological traits7

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Pectis imberbis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF21 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Pectis imberbis is a species of flowering plant in the family Asteraceae. It is native to Chihuahua and Sonora in Mexico and Arizona in the United States.Pectis imberbis. Plant Abstracts. Arizona Game and Fish Department.Pectis imberbis. Flora of North America. It is known by the common names beardless chinchweed, beardless fetid-marigold, hierba de venado, and tall chinchweed. This species is a perennial herb growing erect up to 1.2 meters tall from a woody caudex. The linear leaves are up to 5 centimeters long and only 1 or 2 millimeters wide. Flower heads are borne singly or in loose arrays. Each flower head has a cylindrical body lined with glandular phyllaries. It contains 5 yellow ray florets with a few disc florets at the center. The florets may turn reddish or purple with age. Flowering occurs after summer rainfall in August through October. This plant grows in many kinds of habitat, including woodland, grassland, and dry shrubland. It can generally thrive in disturbed habitat, but overgrazing may eliminate populations.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Pectis imberbis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
2,2':5',2''-Terthiophene		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pectis imberbis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ524954.1 ↗697 bpUSA

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCGTAGCAGAACAACTTGTGAACTTGTAATAACAACATGGCTTT …

Pectis imberbis voucher Mark Fishbein 1508 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pectis imberbis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 121×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Keil 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type21 records

Wild obs. + sensor7

Museum / vouchered14

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤1 km 1>10 km 6

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 7≤10 km 3

10 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	4
Austin, US	4
Riverside, US	2
EL PASO, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Austin, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

7 institutions · 14 of 14 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Pectis imberbis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)