Pectis cylindrica — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pectis

At a glance

Occurrence records214

Data sources10

Biological traits8

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Pectis cylindrica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF214 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Pectis cylindrica, the Sonoran cinchweed, is an annual plant and species of Pectis. Pectis cylindrica is native to the southwestern United States (Arizona, New Mexico and Texas) and in northwestern Mexico (Baja California Sur, Chihuahua, Coahuila, Durango, Nuevo León, Sinaloa, Sonora).Flora of North America v 21 p 225.Rydberg, Per Axel. North American Flora 34(3): 198. 1916. Pectis cylindrica is similar to Pectis prostrata and the two occasionally grow together. Some herbaria contain mixed collections of the two although no evidence is available of hybrids between them.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pectis cylindrica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ524933.1 ↗701 bpMexico

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCTACCACGACAACTTGCGAACTTGTATCAATAACATGGCT …

Pectis cylindrica voucher A.L. Reina G. 2006-507 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2ITS2ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pectis cylindrica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×CCDB · eflora

CCDB · eflora

n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Keil, D. J. 1977. Chromosome studies in North and Central American species of Pectis L. (Compositae: Tageteae). Rhodora 79(817): 79–94.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type214 records

Wild obs. + sensor71

Museum / vouchered143

Origin

Native1

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 39≤1 km 4≤10 km 3>10 km 7

53 georeferenced · 18 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 31≤1 km 8≤10 km 4>10 km 6

49 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence143

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	38
Austin, US	13
San Diego, US	11
EL PASO, US	9
Bronx, US	7
Guasave, MX	7
Riverside, US	7
Mexico City, MX	6
Durango, MX	5
Phoenix, US	5
Albuquerque, US	4
San Luis Obispo, US	3
Pullman, US	3
Flagstaff, US	3
South Kensington, GB	2
Lubbock, US	2
La Paz, MX	2
Saint Louis, US	2
CASlocation not on record	1
Ensenada, MX	1
Wuzhou, CN	1
Hermosillo, MX	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Montréal, CA	1
University of Stellenboschlocation not on record	1
Provo, US	1
Fort Worth, US	1
Claremont, US	1

28 institutions · 139 of 143 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Pectis cylindrica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.