Pectis angustifolia

Torr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pectis

At a glance

Occurrence records632

Data sources10

Biological traits87

DNA specimens0

eDNA detections5

Sources10 archives

Databases and archives Pectis angustifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility632 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources87 traits

Occurrence & distributionGBIF632 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Pectis angustifolia, the lemonscented cinchweed, is a summer blooming annual plant which is found in Western North America, generally from Nebraska and Colorado to Arizona and Mexico. It is in flower from July to October, and the seeds ripen from September to October. Lemonscented cinchweed cannot grow in the shade. The plant is carminative and emetic. The crushed leaves have been used in the treatment of stomach aches. Among the Hopi of Arizona it was known as taichima and was eaten boiled with green corn.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTUSDATRY

Size & morphology2

Plant height0.21 m

Seed mass1.13 mg

Life cycle & reproduction22

Bloom periodLate Spring

Coppice potentialNo

Flower colouryellow

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDAModerate

Life spanannual

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formtherophyte

Resprout abilityNo

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment23

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

Growth form USDABunch

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min8 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry20

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceHigh

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceLow

Frost free days min280 days

Moisture useLow

Nitrogen fixation levelNone

Photosynthetic pathwayC4

Precipitation max18 in

Precipitation min12 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceHigh

Soil pH max7.2 pH

Soil pH min5.9 pH

Temperature min-23 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound400 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pectis angustifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ525060.1 ↗693 bpUSA

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCTAGCACAACAACTTGCGAACCTGTAAGAATAACATGGCTCTAC …

Pectis angustifolia var. fastigata voucher D.R. Hansen 148 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pectis angustifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 243×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Turner, Flyr 1966

n 1211×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +2

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ward, D. E. 1983. Chromosome counts from New Mexico and southern Colorado. Phytologia 54: 302–309.

CCDB · ipcn-api-dl — Reveal, J. L. & R. Spellenberg. 1976. Miscellaneous chromosome counts of Western American plants - III. Rhodora 78: 37–52.

CCDB · ipcn-api-dl — Keil, D. J. 1977. Chromosome studies in North and Central American species of Pectis L. (Compositae: Tageteae). Rhodora 79(817): 79–94.

CCDB · book-ipcn66 — Turner &Flyr 1966

CCDB · book-ipcn67-71 — POWELL, A.M. & s. SIKES. 1970. Chromosome numbers of some chihuahuan desert Compositae. Southw. Naturalist 15: 175-186.

CCDB · book-ipcn73-74 — TURNER, B.L;, A.M. POWELL, & T.J. WATSON, JR. 1973. Chromosome numbers in Asteraceae. Amer. J. Bot. 60: 592-596.

CCDB · book-ipcn73-74 — URBATSCH, L.E. 1974. In IOPB chromosome number reports XLV. Taxon 23: 619-624.

CCDB · Cave1963 — Powell & T. 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type632 records

Wild obs. + sensor264

Museum / vouchered368

Origin

Native10

Range

Area of Occupancy AOO1 984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 148≤1 km 20≤10 km 11>10 km 19

198 georeferenced · 66 without coordinates

Open the mapobservation + sensor264

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 75≤1 km 53≤10 km 63>10 km 13

204 georeferenced · 164 without coordinates

Open the institutions mapphysical evidence368

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	59
Flagstaff, US	39
EL PASO, US	31
Mexico City, MX	29
DOI/NPS, Colonial National Historical Parklocation not on record	28
Bronx, US	24
Fort Worth, US	15
La Paz, MX	13
Durango, MX	13
Musee des Dinosaures d'Esperaza (Aude)location not on record	12
Denver, US	11
Lincoln, US	10
Guasave, MX	10
Austin, US	9
ASUlocation not on record	6
Bangkok, TH	5
Saint Louis, US	5
Phoenix, US	5
Chadron, US	5
Provo, US	4
Bloomington, US	4
DOI/NPS, Greenbelt Parklocation not on record	4
Ciudad Juárez, MX	3
Emporia, US	2
San Angelo, US	2
Riverside, US	2
Mississippi State, US	2
Boise, US	2
Lubbock, US	1
Tuscaloosa, US	1
Pullman, US	1
San Luis Obispo, US	1
Chongqing Museumlocation not on record	1
Tempe, US	1
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	1
Zacatecas, MX	1
USFSlocation not on record	1
Fargo, US	1
LDlocation not on record	1

39 institutions · 365 of 368 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Pectis angustifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)