Pectinatella magnifica

(Leidy, 1851) · species

image placeholder — illustration coming later

Animalia/Bryozoa/Phylactolaemata/Plumatellida/Pectinatellidae/Pectinatella

At a glance

Occurrence records4 738

Data sources9

Biological traits2

DNA specimens7

eDNA detections6

Sources9 archives

Databases and archives Pectinatella magnifica's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 738 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.78 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 738 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT782 Mbp

01Narrative

Pectinatella magnifica, the magnificent bryozoan, is a member of the Bryozoa phylum, in the order Plumatellida. It is a colony of organisms that bind together; these colonies can sometimes be 60 centimeters (2 feet) in diameter. These organisms can be found mostly in North America with some in Europe. They are often found attached to objects, but can be found free floating as well. They form a translucent body with many star-like blooms along the outside. The density of the organism is similar to that of gelatin, and is easily breakable into smaller chunks.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonesessile

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pectinatella magnifica has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

274Cvariable

AACTTTATATTTTTTATTTGGAATGTGGTCTGGGCTAATTGGAAGAAGACTAAGATTTCTAATTCGAGCAGAGCTCGGACAACCTGGGGC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_038192 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND3ATP8COX1ATP6COX3ND2COX2ND5ND4ND4LCYTBND6ND112S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Pectinatella magnifica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size782 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pectinatella magnifica0.78 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type4 738 records

Wild obs. + sensor4 653

Museum / vouchered61

Other24

Origin

Introduced6

Range

Area of Occupancy AOO10 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 3 164≤1 km 370≤10 km 360>10 km 365

4 259 georeferenced · 394 without coordinates

Open the mapobservation + sensor4 653

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 1≤1 km 9≤10 km 24>10 km 4

38 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	22
New Haven, US	15
Chicago, US	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Saint John, CA	3
Toronto, CA	3
South Kensington, GB	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
State University of New York Buffalo State College, Great Lakes Centerlocation not on record	1
Montgomery, US	1
Washington, US	1

11 institutions · 61 of 61 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Pectinatella magnifica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Shallow Lake

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 22.2–22.2

Seasonal swing summer↔winter25.9 °C

Max temp (day)25.7 °C

Min temp (night)19.2 °C

Precipitation76.6 mm/mo

Air humidity59.7 %

Moisture balance-77.2 mm/mo

Vapour deficit1,075 Pa

Wind speed2.30 m/s

Cloud cover36.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pectinatella magnifica

At a glance

Sources9 archives

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Record type4 738 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 738 records