Pectenia cyanoloma

(Schaer.) P.M.Jørg., L.Lindblom, Wedin & S.Ekman · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Peltigerales/Pannariaceae/Pectenia

At a glance

Occurrence records1 808

Data sources7

Biological traits0

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Pectenia cyanoloma's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 808 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 808 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceNCBI≈25 Mbp

01Narrative

Degelia cyanoloma is a species of blue-grey to lead-grey foliose lichen in the family Degelia. It mostly grows on mossy trees in undisturbed woodlands. It is found in the Scottish Highlands, western Ireland and Norway (as well as less prolifically in Spain, France and Portugal), as it grows in maritime Atlantic climates. Degelia cyanoloma was previously thought to be a variant of Degelia plumbea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pectenia cyanoloma has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences2

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC618689.1 ↗506 bp

ACGT

CCGAGAGCGAAGCCTGGCTTCAGGGGCCAACCGCCCCGGCTCTTCACCCCGTGCGCACCGTACCGCCGTCGCTTCGGCGGGAGGCCGGGG …

Pectenia cyanoloma voucher 1995, Purvis, James & Smith (BM) internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceNCBI

The complete instruction manual Pectenia cyanoloma carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈25 436 447 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Pectenia cyanoloma0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 808 records

Wild obs. + sensor1 635

Museum / vouchered173

Range

Area of Occupancy AOO3 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 715≤1 km 601≤10 km 274

1 590 georeferenced · 45 without coordinates

Open the mapobservation + sensor1 635

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 107≤1 km 18≤10 km 11>10 km 1

137 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	63
Bergen, NO	59
Trondheim, NO	32
BioFokuslocation not on record	6
LDlocation not on record	3
University of Oslo, Natural History Museumlocation not on record	2
Royal Botanic Gardens, Kewlocation not on record	1
nbflocation not on record	1
Uppsala, SE	1
MFUlocation not on record	1

10 institutions · 169 of 173 vouchered records shown · 4 without an institution code

09Environmental DNA4 detections

Where the DNA of Pectenia cyanoloma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

paa stein i beite

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.20 °C 4.60–7.20

Seasonal swing summer↔winter10.1 °C

Max temp (day)6.20 °C 5.50–8.60

Min temp (night)4.10 °C 3.00–5.50

Precipitation82.8 mm/mo 74.1–233

Air humidity62.1 % 61.0–69.2

Moisture balance11.6 mm/mo -15.3–186

Vapour deficit335 Pa 261–398

Wind speed6.50 m/s 5.90–7.50

Cloud cover50.2 % 49.9–53.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pectenia cyanoloma

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 808 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 808 records