Paysonia lescurii

(A.Gray) O'Kane & Al-Shehbaz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Paysonia

At a glance

Occurrence records192

Data sources9

Biological traits13

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Paysonia lescurii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility192 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF192 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Paysonia lescurii is a species of flowering plant in the family Brassicaceae known by the common names Lescur's bladderpod or Nashville mustard. It is native to Middle Tennessee, where it can be found in wet fields, lawns, and roadsides. It is also present in neighboring areas of Kentucky and Alabama.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.8 mg

Seed mass max0.8 mg

Seed mass min0.8 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Paysonia lescurii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Glucosinolates1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] 7-methylsulfanyl-N-sulfooxyheptanimidothioate		present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paysonia lescurii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT175802.1 ↗551 bpUSA

ACGT

ACTCGTGGCGGGCTGGTTCTTAATTGATCCCTTGCCCGCTGAATCCGTGGTTTCGTGTACTGATCGGATCGTGAGATTTCTCACAGATTG …

Paysonia lescurii clone 1_I_b internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Paysonia lescurii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Rollins 1957

n 84×CCDB · book-ipcn66 · CCDB · brass · CCDB · Cave1957

CCDB · book-ipcn66 — Rollins1966

CCDB · brass — Rollins

CCDB · Cave1957 — Rollins

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type192 records

Wild obs. + sensor173

Museum / vouchered19

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 112≤1 km 28>10 km 13

153 georeferenced · 20 without coordinates

Open the mapobservation + sensor173

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 2≤1 km 3≤10 km 4>10 km 3

12 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	4
Chapel Hill, US	3
San Diego, US	3
Little Rock, US	2
Bloomington, US	2
Moscow State Universitylocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
US	1

8 institutions · 17 of 19 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)