Paypayrola blanchetiana

Tul. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Violaceae/Paypayrola

At a glance

Occurrence records364

Data sources6

Biological traits11

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Paypayrola blanchetiana's data was compiled from.

GBIFGlobal Biodiversity Information Facility364 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF364 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height max10 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paypayrola blanchetiana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKC699606.1 ↗1 300 bpBrazil

ACGT

TTGGATTCAAAGCTGGGGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCC …

Paypayrola blanchetiana voucher Paula-Souza et al. 5682 (ESA) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type364 records

Wild obs. + sensor17

Museum / vouchered347

Origin

Native188

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 6≤1 km 4≤10 km 4>10 km 2

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 344 without coordinates

Open the institutions mapphysical evidence347

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	62
CEPLAClocation not on record	42
Chaguaramas, TT	40
Salvador, BR	27
UFPElocation not on record	19
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	17
UFBAlocation not on record	16
JBRJlocation not on record	16
Laboratorio de Ictiologialocation not on record	15
USP-IBlocation not on record	12
Departamento de Sistematica e Ecologialocation not on record	11
San Jose State University, Museum of Birds and Mammalslocation not on record	10
Feira de Santana, BR	8
Brasília, BR	5
UFRPElocation not on record	3
Cruz das Almas, BR	3
Saint Louis, US	3
Chicago, US	2
UFESlocation not on record	2
UNICAPlocation not on record	2
UNIVASFlocation not on record	2
CEPEC, CEPLAC e Universidade Federal do Sul da Bahialocation not on record	2
Kew, GB	1
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	1
Masindi, UG	1
UFPRlocation not on record	1
Federal University of Espírito Santolocation not on record	1
Universidade Federal do Maranhãolocation not on record	1
ASUlocation not on record	1
VALElocation not on record	1
UFSClocation not on record	1
UESBlocation not on record	1

32 institutions · 329 of 347 vouchered records shown · 17 without an institution code

09Environmental DNA1 detections

Where the DNA of Paypayrola blanchetiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)