Paxillus vernalis

Watling · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Paxillaceae/Paxillus

At a glance

Occurrence records83

Data sources9

Biological traits0

DNA specimens2

eDNA detections23

Sources9 archives

Databases and archives Paxillus vernalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility83 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF83 records

Environmental DNA3 datasets · 2 countries23 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Paxillus vernalis is a basidiomycete fungus found in montane forests in northern North America. It closely resembles the poisonous Paxillus involutus, and is considered likely to also be poisonous. The fungus was described as new to science by Scottish mycologist Roy Watling in 1969.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paxillus vernalis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections23

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOP150372.1 ↗318 bpUSA · 1995

ACGT

AACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATCCCTCGATTCGTTTCGAGGTTT …

Paxillus vernalis voucher DBG:F-018220 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type83 records

Wild obs. + sensor9

Museum / vouchered74

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 6 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 2≤1 km 3≤10 km 10>10 km 3

18 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	19
St. Paul, US	7
Ann Arbor, US	4
Copenhagen, DK	3
TENN-Flocation not on record	2
Bronx, US	2
Chicago, US	2
Université de Montréal Biodiversity Centrelocation not on record	2
Durham, US	1
WTUlocation not on record	1
Tartu, EE	1
ILLSlocation not on record	1
LDlocation not on record	1
Helsinki, FI	1

14 institutions · 47 of 74 vouchered records shown · 26 without an institution code

09Environmental DNA23 detections

Where the DNA of Paxillus vernalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys3

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature25.0 °C

pH5.21 4.50–8.70

Conductivity39.0 µS/cm 16.0–202

Organic carbon1.18 % 0.004–5.69

Water content18.3 % 3.56–38.4

Nitrate-N5.00 mg/kg 0.006–71.0

Phosphorus22.0 mg/kg 3.00–239

Clay8.05 % 3.31–48.6

Sand85.1 % 23.1–94.2

Depth0 m 0–0.2

SoilDermosolSodosolKandosolFerrosolPodosolCalcarosol

21 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 12.7–22.2

Seasonal swing summer↔winter9.20 °C

Max temp (day)22.7 °C 15.7–27.2

Min temp (night)14.2 °C 10.3–17.8

Precipitation93.2 mm/mo 32.6–135

Air humidity58.2 % 56.5–60.9

Moisture balance-30.1 mm/mo -91.7–13.2

Vapour deficit820 Pa 635–1,103

Wind speed4.10 m/s 1.70–5.10

Cloud cover23.9 % 17.5–26.4

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)