Paxillus filamentosus

Fr. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Paxillaceae/Paxillus

At a glance

Occurrence records1 251

Data sources8

Biological traits0

DNA specimens4

eDNA detections7

Sources8 archives

Databases and archives Paxillus filamentosus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 251 records

Environmental DNA2 datasets · 4 countries7 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Paxillus filamentosus, commonly known as the alder roll-rim, is a basidiomycete fungus which is associated with alder (Alnus) in northern Europe and southwestern Greenland, and North America. It closely resembles Paxillus involutus, but its fruit bodies are generally smaller. Some sources regard Paxillus rubicundulus as a synonym, but MycoBank and Index Fungorum treat it as different species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paxillus filamentosus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences5

eDNA detections7

Countries4

The DNA barcodea real sequence read deposited for this species

ITSJF961364.1 ↗615 bp

ACGT

GAACCTGCGGAAGGATCATTATTGAATGAACTTGGTATGATTGTTGCTGGCCCATCTGGGCATGTGCACGTCTGCCATCTTTATCTCTCC …

Pholiota filamentosa 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type1 251 records

Wild obs. + sensor1 010

Museum / vouchered235

Other6

Range

Area of Occupancy AOO3 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 466≤1 km 87≤10 km 369>10 km 11

933 georeferenced · 77 without coordinates

Open the mapobservation + sensor1 010

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 5≤1 km 30≤10 km 9>10 km 18

62 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence235

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	25
Joensuu, FI	17
WU-MYClocation not on record	14
Copenhagen, DK	13
San Sebastián, ES	11
Karlsruhe, DE	10
Adam Mickiewicz University in Poznańlocation not on record	8
BDBClocation not on record	8
Tartu, EE	6
LDlocation not on record	5
Universidade de Lisboa, Museu Bocagelocation not on record	5
Philadelphia, US	5
Göteborg, SE	3
GJOlocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
Warsaw, PL	2
TENN-Flocation not on record	2
HabitatVisionlocation not on record	1
Tromso University Museumlocation not on record	1
Entomological Society of Latvialocation not on record	1
Tilburg, NL	1
Vitoria, ES	1
MAlocation not on record	1
Chicago, US	1
Bardejov, SK	1
University of Oslo, Natural History Museumlocation not on record	1
Vancouver, CA	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1

29 institutions · 151 of 235 vouchered records shown · 84 without an institution code

09Environmental DNA7 detections

Where the DNA of Paxillus filamentosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

Vegkant (grus) med gran, furu og grÃ¥or pÃ¥ …Alnus glutinosa, by track, broad leaved deci…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 10.0–17.6

Seasonal swing summer↔winter18.4 °C

Max temp (day)16.2 °C 11.5–20.5

Min temp (night)10.6 °C 7.50–14.4

Precipitation93.2 mm/mo 66.4–235

Air humidity63.3 % 60.3–64.3

Moisture balance13.6 mm/mo -58.0–189

Vapour deficit582 Pa 449–783

Wind speed2.80 m/s 2.40–4.80

Cloud cover42.9 % 35.0–55.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Paxillus filamentosus

At a glance

Sources8 archives

At a glance

Record type1 251 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 251 records