Paxillus cuprinus

Jargeat, Gryta, J.-P.Chaumeton & Vizzini · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Paxillaceae/Paxillus

At a glance

Occurrence records499

Data sources7

Biological traits0

DNA specimens19

eDNA detections734

Sources7 archives

Databases and archives Paxillus cuprinus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility499 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI734 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF499 records

Environmental DNA4 datasets · 19 countries734 detections

DNA & barcodingBOLD · NCBI19 specimens

01Narrative

Paxillus cuprinus Jargeat, Gryta, J.-P. Chaumeton & Vizzini – gatunek grzybów z rodziny krowiakowatych.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paxillus cuprinus has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes2

GenBank sequences9

eDNA detections734

Countries19

The DNA barcodea real sequence read deposited for this species

ITSKY777360.1 ↗670 bpUSA · 2014

ACGT

GAAGGATCATTATCGAAAAGCAATCCGGGGGGAGGCCACCGAGCGAAGTTTGGTAGATCGTAGGGATTGTCGCTGGCCTTTGGAAACGAA …

Paxillus cuprinus strain MGW1376 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type499 records

Wild obs. + sensor397

Museum / vouchered102

Range

Area of Occupancy AOO1 340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 211≤1 km 39≤10 km 82>10 km 12

344 georeferenced · 53 without coordinates

Open the mapobservation + sensor397

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 10≤1 km 5

15 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	43
Auckland, NZ	10
Kew, GB	6
Copenhagen, DK	3
SLU Artdatabankenlocation not on record	2
TENN-Flocation not on record	2
WTUlocation not on record	2
WU-MYClocation not on record	1
St. Paul, US	1
JA-CAGPDS-CAMlocation not on record	1
Karlsruhe, DE	1

11 institutions · 72 of 102 vouchered records shown · 15 without an institution code

09Environmental DNA734 detections

Where the DNA of Paxillus cuprinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found734

Studies independent surveys4

Countries19

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 734 detections have coordinates

Open the map19 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.0 °C 14.0–25.0

pH5.80 4.70–6.40

Conductivity85.0 µS/cm 74.0–153

Organic carbon3.35 % 2.50–4.23

Nitrate-N6.00 mg/kg 2.00–22.0

Phosphorus86.0 mg/kg 24.0–104

Clay22.2 % 13.0–28.2

Sand67.8 % 61.7–85.0

Depth0 m

SoilVertosolSodosolLatLon out of range

5 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 9.40–17.8

Seasonal swing summer↔winter22.2 °C

Max temp (day)19.0 °C 12.5–21.8

Min temp (night)12.5 °C 5.90–15.0

Precipitation75.2 mm/mo 62.7–94.5

Air humidity62.0 % 57.9–65.1

Moisture balance-1.60 mm/mo -51.5–53.3

Vapour deficit699 Pa 438–811

Wind speed3.30 m/s 2.30–4.70

Cloud cover42.5 % 35.0–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 728 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)