Pavetta australiensis

Bremek. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Pavetta

At a glance

Occurrence records720

Data sources6

Biological traits34

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Pavetta australiensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility720 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF720 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Pavetta australiensis là một loài thực vật có hoa trong họ Thiến thảo. Loài này được Bremek. mô tả khoa học đầu tiên năm 1934.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length7 mm

Fruit width6.5 mm

Leaf length95 mm

Leaf length max150 mm

Leaf length min40 mm

Leaf width35 mm

Leaf width max60 mm

Leaf width min10 mm

Petiole length1.25 cm

Plant height7 m

Plant height max7 m

Seed length4.5 mm

Seed mass219 mg

Seed mass max219 mg

Seed mass min219 mg

Seed width4.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timeyyyyyynnnnnn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_elliptical oblanceolate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pavetta australiensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896165.1 ↗511 bpAustralia · 2012

ACGT

TTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCGGGAGTTCCACCTGAAGAAGC …

Pavetta australiensis voucher 1076419060 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type720 records

Wild obs. + sensor277

Museum / vouchered192

Other251

Origin

Native3

Range

Area of Occupancy AOO2 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 129≤1 km 26≤10 km 7>10 km 24

186 georeferenced · 91 without coordinates

Open the mapobservation + sensor277

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 18≤1 km 19≤10 km 75>10 km 4

116 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence192

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	98
Canberra, AU	28
Brisbane, AU	16
Palmerston, AU	8
Kew, GB	7
James Cook Townsvillelocation not on record	5
Armidale, AU	4
Mount Annan, AU	3
Museo Entomologico de Leonlocation not on record	2
Adelaide, AU	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
IPA/SPlocation not on record	1
Hobart, AU	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Kensington, AU	1
Zürich, CH	1
Saint Louis, US	1

17 institutions · 180 of 192 vouchered records shown · 12 without an institution code

09Environmental DNA1 detections

Where the DNA of Pavetta australiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.9–25.9

Seasonal swing summer↔winter8.70 °C

Max temp (day)28.1 °C

Min temp (night)23.6 °C

Precipitation202 mm/mo

Air humidity65.3 %

Moisture balance51.9 mm/mo

Vapour deficit1,151 Pa

Wind speed2.70 m/s

Cloud cover45.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)