Paurocotylis pila

Berk. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Pyronemataceae/Paurocotylis

At a glance

Occurrence records671

Data sources8

Biological traits0

DNA specimens1

eDNA detections3

Sources8 archives

Databases and archives Paurocotylis pila's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility671 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF671 records

Environmental DNA2 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Paurocotylis es un género de hongos de la familia Pyronemataceae. El género es monotípico, su única especie es Paurocotylis pila, es un hongo tipo trufa propio de Europa y Nueva Zelanda. Fue descrito por Miles Joseph Berkeley en la publicación The Botany of the Antarctic Voyage II, Flora Novae-Zealandiae de Joseph Dalton Hooker, 1855.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paurocotylis pila has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEU784395.1 ↗773 bp

ACGT

GTCATTTAGAGGAAGTAAAGTCGTAACAAGGTTCCGTAGGTGACTGCGGAAGGATCATTAAAAAAGCATCACACGGGGGTGAAAAGCTCC …

Paurocotylis pila voucher RBG Kew K(M)47945 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type671 records

Wild obs. + sensor511

Museum / vouchered159

Cultivated / captive1

Range

Area of Occupancy AOO1 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 223≤1 km 111≤10 km 66>10 km 9

409 georeferenced · 102 without coordinates

Open the mapobservation + sensor511

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 1≤1 km 7≤10 km 2

10 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence159

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	130
Bernard Price Institute for Palaeontological Researchlocation not on record	8
Kew, GB	5
Leicester, GB	3
Durham, US	2
Royal Botanic Gardens, Kewlocation not on record	1
Hobart, AU	1
St. Paul, US	1
DPIlocation not on record	1

9 institutions · 152 of 159 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Paurocotylis pila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 6.60–13.8

Seasonal swing summer↔winter10.3 °C

Max temp (day)18.7 °C 9.30–18.7

Min temp (night)9.60 °C 3.60–9.60

Precipitation83.4 mm/mo 83.4–92.8

Air humidity59.9 % 59.9–66.8

Moisture balance-52.4 mm/mo -52.4–42.1

Vapour deficit631 Pa 347–631

Wind speed5.20 m/s 5.20–5.40

Cloud cover39.4 % 39.4–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)