Paulownia tomentosa
(Thunb.) Steud. · speciesAt a glance
Occurrence records52 428
Data sources15
Biological traits123
DNA specimens11
eDNA detections7
Sources15 archives
Databases and archives Paulownia tomentosa's data was compiled from.
WikipediaWikimedia Foundation15 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility52 428 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources123 traits
Chemical compositionLOTUS · NPASS169 compounds
Occurrence & distributionGBIF52 428 records
Environmental DNA1 datasets · 4 countries7 detections
DNA & barcodingBOLD · NCBI11 specimens
Genome at a glanceCCDB · GoaT · NCBI645 Mbp
01Narrative
Paulownia coreana, also called Paulownia glabrata or Korean paulownia, is an indigenous species of South Korea. It is cultivated in South Pyongan and south of Gyeonggi.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYAusTraitsGIFTUSDA
Size & morphology16
Fruit length38.75 mm
Fruit length max45 mm
Fruit length min30 mm
Inflorescence length max50 cm
Leaf length400 mm
Leaf length max250 mm
Leaf width200 mm
Leaf width max200 mm
Leaf width min200 mm
Plant height20.5 m
⚠ sources differ — GIFT: 20.5 m · USDA: 21.34 m · TRY: 17.41 m
Plant height max20 m
Plant height min10 m
Seed length2.5 mm
Seed mass0.207 mg
Seed mass max0.34 mg
Seed mass min0.1 mg
Life cycle & reproduction30
Bloom periodMid Spring
Coppice potentialYes
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dispersal typewind
Flower colourpurple
Flower conspicuousYes
Flowering endMay
Flowering startApr
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryModerate
Pollination syndromebee
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualpresent
Resprout abilityYes
Seed spread rateSlow
Seedling vigorHigh
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 800 m
Elevation mean1 800 m
Elevation min1 800 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Growth formtree
Growth form USDASingle Crown
Habitat GIFTLowland
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.0000000509
Root depth min36 in
Shape and orientationIrregular
Small grainNo
Woodinesswoody
Physiology & chemistry25
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Frost free days min180 days
Leaf C:N ratio18.5 g/g
Leaf c491 mg/g
Leaf dry-matter content (LDMC)182 mg/g
Leaf n21.48 mg/g
Leaf p2.09 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min30 in
Salinity toleranceNone
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min4.5 pH
Temperature min-8 °F
Wood density307 mg/cm³
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productMedium
Lumber productYes
Naval store productYes
Nursery stock productYes
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound2 820 000 per lb
ToxicityNone
Veneer productNo
Other traits8
Diaspore typeseed
Fall conspicuousYes
Fruit seed abundanceLow
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr18.29 m
Planting density max800 per acre
Planting density min400 per acre
03Chemical composition169 compounds
Compounds documented for Paulownia tomentosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavanones87
Dihydroflavonols23
Monoacylglycerols13
Cinnamic acids and derivatives $ Phenylethanoids10
Iridoids monoterpenoids7
Documented compounds169 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Eriodictyol | present | LOTUS | |
| (+)-taxifolin | present | NPASS | |
| (-)-Asarinin | present | NPASS | |
| (1S,2R,4aS,6aR,6aS,6bR,8aS,10S,12aR,14bS)-10-hydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid | present | NPASS | |
| (1S,4aS,5S,6S,7S,7aS)-7-(hydroxymethyl)-1-[(2R,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-5,6,7-triol | present | LOTUS | |
| (2R,3R)-2-(3,4-dihydroxy-5-methoxyphenyl)-3,5,7-trihydroxy-6-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2R,3R)-2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-6-[(2E,6R)-6-hydroxy-3,7-dimethylocta-2,7-dienyl]-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2R,3R)-2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-6-[(E)-7-hydroxy-3,7-dimethyloct-2-enyl]-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2R,3R)-3,5,7-trihydroxy-2-(4-hydroxy-3-methoxyphenyl)-6-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2R,3R)-3,5,7-trihydroxy-6-[(2E,6R)-6-hydroxy-3,7-dimethylocta-2,7-dienyl]-2-(4-hydroxy-3-methoxyphenyl)-2,3-dihydrochromen-4-one | present | LOTUS |
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paulownia tomentosa has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes5
GenBank sequences8
eDNA detections7
Countries4
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCGCCCCCCTCCCGCGCTCCTCCGGGGCGACGGGCGAGGGGGGCGGACAATGGCCTCCCGTGCGCCCCGCGCGCGCGGCCG …
Paulownia tomentosa isolate PT201505 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL4★rbcLa★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Paulownia tomentosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size645 480 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Paulownia tomentosa0.65 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidydiploid inferred
Chromosome records34–402n range40median40mode15records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4014×CCDB · slov-fl · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +3
CCDB · slov-fl — Feráková V., 1992: Paulownia tomentosa (Thunb.) Steud. - neofyt dendroflóry teplej klimatickej oblasti Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Format. Protect. Nat. 16: 45-48.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3589
CCDB · ipcn-api-dl — Shu, S. L. 1985. A survey of the chromosome number of four species of Paulownia. Acta Agric. Univ. Henan. 19(1): 48–51.
CCDB · ipcn-api-dl — Yu, Z. y., S. f. Li, G. y. Hsu & Y. p. Hsu. 1987. A preliminary study on the number and morphology of chromosomes in Paulownia. Acta Bot. Boreal.-Occid. Sin. 7: 127–133.
CCDB · ipcn-api-dl — Liang, Z. y. & Z. y. Chen. 1997. A cytotaxonomical study of the genus Paulownia in China. J. Huazhong Agric. Univ. 16(6): 609–613.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · book-indian_vol1 — Westfall, J.J. 1949
CCDB · book-atlas-flowering-plants — Westfall 1949
CCDB · kew — Garcia S, Garnatje T, Hildalgo O, Mas de Xaxars G, Pellicer J, Sanchez-Jimenez D, Vitales D, Valles J. 2010. First genome size estimations for some eudicot families and genera. Collectanea Botanica (Barcelona) 29: 7-16.
2n 341×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Delay, C. 1947
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99% BUSCO
08Occurrence & distribution
Record type52 428 records
Wild obs. + sensor50 677
Museum / vouchered1 514
Cultivated / captive205
Other32
Origin
Native3
Introduced212
Range
Area of Occupancy AOO76 132 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 34 836≤1 km 2 658≤10 km 3 314>10 km 632
41 440 georeferenced · 9 237 without coordinates
Open the mapobservation + sensor50 677
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 77≤1 km 169≤10 km 190>10 km 30
466 georeferenced · 1 048 without coordinates
Open the institutions mapphysical evidence1 514
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy9% within 1 km
≤100 m 2≤10 km 21
23 georeferenced · 182 without coordinates
Open the mapnot free-living205
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions142 of 223 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 75 |
| Zhengzhou, CN | 71 |
| Yangling, CN | 62 |
| Wuhan, CN | 61 |
| Odawara, JP | 57 |
| Philadelphia, US | 41 |
| College Park, US | 36 |
| Allentown, US | 36 |
| Sanda, JP | 35 |
| Williamsburg, US | 34 |
| Chongqing Museumlocation not on record | 34 |
| Auckland, NZ | 28 |
| Rotorua, NZ | 28 |
| Nagano City, JP | 28 |
| University of Stellenboschlocation not on record | 25 |
| Chapel Hill, US | 24 |
| BIO-UNIPIlocation not on record | 23 |
| Kochi, JP | 22 |
| Bronx, US | 22 |
| Bangkok, TH | 20 |
| PRClocation not on record | 20 |
| Blumenau, BR | 18 |
| KR | 16 |
| WTUlocation not on record | 14 |
| Nanjing, CN | 14 |
| Saint Louis, US | 12 |
| Mississippi State, US | 12 |
| Millersville, US | 11 |
| Provincia di Livornolocation not on record | 11 |
| Fayetteville, US | 10 |
| Tokushima, JP | 10 |
| WNNUlocation not on record | 10 |
| Norfolk, US | 10 |
| Kunming, CN | 9 |
| Bloomington, US | 9 |
| Fukushima Universitylocation not on record | 9 |
| Hangzhou, CN | 9 |
| Tuscaloosa, US | 9 |
| Otaru, JP | 9 |
| Christchurch, NZ | 8 |
| LDlocation not on record | 8 |
| Shinshu Universitylocation not on record | 8 |
| Chiba, JP | 8 |
| Salzburg, AT | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| Chengdu, CN | 7 |
| Osaka, JP | 7 |
| Fairfax, US | 7 |
| Philadelphia, US | 7 |
| Wuzhou, CN | 7 |
| Kawasaki Shi Tama Ku, JP | 6 |
| Beijing, CN | 6 |
| National Institute of Biological Resourceslocation not on record | 6 |
| Tsukuba, JP | 6 |
| Jackson, US | 6 |
| Xian, CN | 6 |
| Staten Island, US | 6 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 6 |
| Kew, GB | 6 |
| FFPRIlocation not on record | 6 |
| KURAlocation not on record | 6 |
| Toyama, JP | 6 |
| Clemson, US | 5 |
| Burlington, US | 5 |
| Wlocation not on record | 5 |
| Brisbane, AU | 5 |
| Mount Annan, AU | 5 |
| Sendai, JP | 5 |
| Fredericksburg, US | 5 |
| Sagamihara, JP | 5 |
| New Brunswick, US | 5 |
| China Agricultural Universitylocation not on record | 5 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 4 |
| Xian, CN | 4 |
| BFLlocation not on record | 4 |
| Berlin, DE | 4 |
| Taipei, TW | 4 |
| MAlocation not on record | 4 |
| MeiseBGlocation not on record | 4 |
| Ivano-Frankivsk, UA | 4 |
| Xining, CN | 4 |
| Denver, US | 4 |
| Morgantown, US | 4 |
| Wuhan, CN | 4 |
| Columbia, US | 4 |
| BAYLUlocation not on record | 4 |
| Lanzhou, CN | 4 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Oskarshamn, SE | 3 |
| Washington, US | 3 |
| GAlocation not on record | 3 |
| Bando, JP | 3 |
| Cascavel, BR | 3 |
| Knoxville, US | 3 |
| Corvallis, US | 3 |
| Córdoba, AR | 3 |
| Richmond, US | 3 |
| SLU Artdatabankenlocation not on record | 3 |
| nlocation not on record | 3 |
| St. Paul, US | 3 |
| Durban, ZA | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Görlitz, DE | 3 |
| PUC-RSlocation not on record | 3 |
| Nijmegen, NL | 3 |
| Canberra, AU | 3 |
| Chengdu, CN | 3 |
| US | 3 |
| Smithfield, AU | 2 |
| Guilin, CN | 2 |
| Madison, US | 2 |
| Londrina, BR | 2 |
| Adelaide, AU | 2 |
| TAFORI-LSRClocation not on record | 2 |
| UTFPR-DVlocation not on record | 2 |
| Vitoria, ES | 2 |
| Russellville, US | 2 |
| Armidale, AU | 2 |
| CICYTEXlocation not on record | 2 |
| Tampa, US | 2 |
| Nishihara, JP | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| ESALQlocation not on record | 2 |
| Portland, US | 2 |
| Frankfurt am Main | 2 |
| GJOlocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Taipei, TW | 2 |
| Guiyang, CN | 2 |
| Guangzhou, CN | 2 |
| San Sebastián, ES | 2 |
| Minia, EG | 2 |
| Central China Normal Universitylocation not on record | 2 |
| New Haven, US | 2 |
| BClocation not on record | 2 |
| Universidad de San Carlos de Guatemalalocation not on record | 1 |
| Tempe, US | 1 |
| Cape Town, ZA | 1 |
| Denton, US | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Seoul, KR | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Conway, US | 1 |
| Urumqi, CN | 1 |
| Porto Alegre, BR | 1 |
| Little Rock, US | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Johnson City, US | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Alicante, ES | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Vancouver, CA | 1 |
| Morelia, MX | 1 |
| Alexandria Universitylocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Dover, US | 1 |
| Mlocation not on record | 1 |
| Dekalb, US | 1 |
| San Angelo, US | 1 |
| Claremont, US | 1 |
| University of New Hampshirelocation not on record | 1 |
| Badajoz, ES | 1 |
| Karlsruhe, DE | 1 |
| Cincinnati, US | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Lincoln, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Springfield, US | 1 |
| Pamplona, ES | 1 |
| Campo Mourão, BR | 1 |
| Nishihara, JP | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Pullman, US | 1 |
| Riverside, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Lake Charles, US | 1 |
| University of Johannesburglocation not on record | 1 |
| Tilburg, NL | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Northridge, US | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Xinxiang, CN | 1 |
| Brookings, US | 1 |
| UChlocation not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| BMlocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| Due West, US | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Mexico City, MX | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Brasília, BR | 1 |
| Phoenix, US | 1 |
| CJBGlocation not on record | 1 |
| Ojo, NG | 1 |
| Zhuzhou, CN | 1 |
| ASUlocation not on record | 1 |
| Austin, US | 1 |
| ENTClocation not on record | 1 |
| BRNUlocation not on record | 1 |
| South Kensington, GB | 1 |
| Shanghai, CN | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Provo, US | 1 |
| Edmonton, CA | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| JP | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| UFSClocation not on record | 1 |
| Hobart, AU | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
223 institutions · 1 457 of 1 514 vouchered records shown · 56 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA7 detections
Where the DNA of Paulownia tomentosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map4 countries0
roadside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.5 °C 15.2–22.6
Seasonal swing summer↔winter13.8 °C
Max temp (day)21.3 °C 20.5–26.0
Min temp (night)11.5 °C 9.60–18.5
Precipitation53.5 mm/mo 16.6–217
Air humidity56.6 % 52.9–63.6
Moisture balance-57.6 mm/mo -68.7–98.4
Vapour deficit822 Pa 803–1,015
Wind speed2.20 m/s 1.80–3.30
Cloud cover34.8 % 21.5–41.6
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.