Passiflora podadenia

Killip · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Passifloraceae/Passiflora

At a glance

Occurrence records99

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Passiflora podadenia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility99 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF99 records

DNA & barcodingNCBIsequences

01Narrative

Passiflora podadenia là một loài thực vật có hoa trong họ Lạc tiên. Loài này được Killip mô tả khoa học đầu tiên năm 1924.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Dispersal typeanimal

Life formclimbing shrub

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climber detailedvine

Epiphyteterrestrial

Growth formclimber

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Passiflora podadenia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW374719.1 ↗252 bpMexico

ACGT

TTTTTGAACGCAAGTTGCGCCCGAAGCCTTCGGGCCAGGGCACGTCTGCCTGGGCGTCACGCATAGCGTCTCACCCACCCCGCCATGCTC …

Passiflora podadenia voucher IBUG:187084 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type99 records

Wild obs. + sensor17

Museum / vouchered82

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 7≤1 km 5≤10 km 2>10 km 1

15 georeferenced · 2 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 15

15 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	11
Mexico City, MX	10
Saint Louis, US	8
University of Stellenboschlocation not on record	8
Claremont, US	7
Austin, US	6
Ann Arbor, US	4
CASlocation not on record	3
Durham, US	3
Autlán de Navarro, MX	3
Madison, US	3
Giardini Botanici Hanburylocation not on record	3
Durango, MX	3
Kew, GB	2
MEXUlocation not on record	2
EL PASO, US	1
IBUGlocation not on record	1
Calabar, NG	1
CHAPAlocation not on record	1
San Diego, US	1
ASUlocation not on record	1

21 institutions · 82 of 82 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)