Parietaria hespera — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Parietaria

At a glance

Occurrence records764

Data sources8

Biological traits10

DNA specimens7

eDNA detections4

Sources8 archives

Databases and archives Parietaria hespera's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility764 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF764 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Parietaria hespera is a species of flowering plant in the nettle family known by the common name rillita pellitory. It is native to the southwestern United States and northwestern Mexico, where it grows in many types of habitat, from coast to desert, dry to moist, and sometimes in disturbed areas. It is an annual herb taking an erect or spreading form up to half a meter long or forming a mat or dense tangle. The stems may branch or not. They are lined with alternately arranged leaves up to 2 centimeters long and varying in shape from oval to round or somewhat kidney-shaped. The inflorescence is a cluster of flowers emerging from the leaf axils. The flower has no petals but greenish sepals which may be tinged yellowish or reddish brown. , The Plant List did not accept this species, regarding its status as unresolved.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parietaria hespera has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF964128.1 ↗667 bpUSA

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTTCGAGCAAAGCAACCCGCGAACGCGTTTGATAAGA …

Parietaria hespera var. hespera isolate CBP409 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL1rbcLaITS2ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type764 records

Wild obs. + sensor368

Museum / vouchered396

Origin

Native22

Range

Area of Occupancy AOO2 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 234≤1 km 21≤10 km 6>10 km 9

270 georeferenced · 98 without coordinates

Open the mapobservation + sensor368

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 43≤1 km 64≤10 km 28>10 km 5

140 georeferenced · 256 without coordinates

Open the institutions mapphysical evidence396

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	98
Phoenix, US	54
Riverside, US	44
Flagstaff, US	30
Claremont, US	27
San Luis Obispo, US	16
US	13
San Diego, US	12
CASlocation not on record	12
Mexico City, MX	9
Northridge, US	7
DOI/NPS, Colonial National Historical Parklocation not on record	7
Hermosillo, MX	6
Austin, US	6
Los Angeles, US	6
EL PASO, US	6
Irvine, US	6
The University of Arizonalocation not on record	5
Henderson, US	5
Santa Barbara, US	4
Catalina Island Conservancylocation not on record	3
Davis, US	3
Ensenada, MX	2
Moscow, US	2
Canadian Department of Agriculturelocation not on record	2
La Paz, MX	2
Clemson, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Arizona Western Collegelocation not on record	1
Arcata, US	1
Albuquerque, US	1
Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record	1
Provo, US	1
Logan, US	1
Cambridge, US	1

35 institutions · 396 of 396 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Parietaria hespera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Coastal Sage and Riparian; GabbroErodium botrys, Selaginella bigelovii, Crass…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 12.1–14.3

Seasonal swing summer↔winter9.60 °C

Max temp (day)17.8 °C 17.6–17.9

Min temp (night)8.60 °C 6.70–10.5

Precipitation66.3 mm/mo 52.8–79.8

Air humidity58.8 % 57.4–60.1

Moisture balance-14.8 mm/mo -37.3–7.80

Vapour deficit625 Pa 602–647

Wind speed1.50 m/s 1.20–1.70

Cloud cover34.4 % 31.4–37.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.