Parietaria debilis
G.Forst. · speciesAt a glance
Occurrence records5 391
Data sources9
Biological traits58
DNA specimens35
eDNA detections17
Sources9 archives
Databases and archives Parietaria debilis's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 391 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics35 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources58 traits
Occurrence & distributionGBIF5 391 records
Environmental DNA1 datasets · 2 countries17 detections
DNA & barcodingBOLD · NCBI35 specimens
Genome at a glanceCCDB2n = 16
01Narrative
Parietaria debilis, commonly known as pellitory, small-flower pellitory, or native pellitory, is a herb native to Australia and New Zealand.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology20
Fruit length1.4 mm
⚠ sources differ — AusTraits: 1.4 mm · GIFT: 1.15 mm
Fruit length max1.3 mm
Fruit length min1 mm
Fruit width0.8 mm
Leaf length17.5 mm
Leaf length max60 mm
Leaf length min5 mm
Leaf size3 142 mm²
Leaf width8 mm
⚠ sources differ — AusTraits: 8 mm · GIFT: 21.5 mm
Leaf width max50 mm
Leaf width min3 mm
Petiole length1.5 cm
Plant height0.25 m
⚠ sources differ — GIFT: 0.25 m · AusTraits: 0.3 m · TRY: 0.2 m
Plant height max0.7 m
Plant height min0.05 m
Seed length1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 1.25 mm
Seed length max1.25 mm
Seed length min1.25 mm
Seed mass0.244 mg
⚠ sources differ — TRY: 0.244 mg · AusTraits: 0.244 mg · GIFT: 0.2 mg
Seed width0.5 mm
Life cycle & reproduction16
Deciduousnessvariable
Dispersal typeanimal
⚠ sources differ — AusTraits: zoochory · GIFT: unspecialized
Flower colourgreen
Flowering endJun
Flowering startFeb
Flowering timennnnnnnyyyyn
Life formannual or subshrub
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromeabiotic
⚠ sources differ — AusTraits: abiotic · GIFT: wind
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Self fertilizationabsent
Sex typepolygamous
⚠ sources differ — AusTraits: polygamous · GIFT: bisexual
Diet & foraging1
Parasiteindependent
Habitat & environment17
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max3 750 m
Elevation mean2 100 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTFloresta Ciliar ou Galeria, Floresta Estacional Decidual, Floresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesssimple
Leaf formorbicular
Leaf shapeovate widely_ovate
Mycorrhizaabsent
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits2
Seeds per fruit11-100
Shoot orientationascending
05DNA & barcoding35 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parietaria debilis has left across the world's sequence archives.
At a glance
DNA specimens35
Marker genes4
GenBank sequences10
eDNA detections17
Countries3
The DNA barcodea real sequence read deposited for this species
AGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACAAATTCAGACTGTGAAACTGCGAATGGCTCATTAAATC …
Parietaria debilis HIRO:HIRO-MY-165765 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 28S rRNA, partial and complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL8★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Parietaria debilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records14–262n range16median16mode7records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 165×CCDB · new-zealand · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +1
CCDB · new-zealand
CCDB · ipcn-api-dl — Fernández, A. M. F. d., M. E. L. d. Canelada, M. S. C. d. Garcá & A. Würschmidt. 1990. Cromosomas de Urticáceas Argentinas. Lilloa 37: 97–98.
CCDB · ipcn-api-dl — de Lange, P. J. & B. G. Murray. 2002. Contributions to a chromosome atlas of the New Zealand flora---37. Miscellaneous families. New Zealand J. Bot. 40: 1–23.
CCDB · book-ipcn72 — MESICEK, J., & J. SOJAK. 1972. Chromosome studies in Mongolian plants. Preslia 44: 334-358.
CCDB · book-indian_vol1 — Mesioek, J. & Sojak, J. 1972
2n 141×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Morton, J. K. 1993. Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159–172.
2n 261×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of plants of the Primorsky Territory, the Amur River basin and Magadan region. Bot. Žhurn. (Moscow & Leningrad) 91(3): 491–509.
n 81×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sun, B. y., T. F. Stuessy & D. J. Crawford. 1990. Chromosome counts from the flora of the Juan Fernández Islands, Chile III. Pacific Sci. 44: 258–264.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 391 records
Wild obs. + sensor3 118
Museum / vouchered2 255
Cultivated / captive1
Other17
Origin
Native861
Introduced29
Range
Area of Occupancy AOO13 520 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy87% within 1 km
≤100 m 1 622≤1 km 941≤10 km 328>10 km 65
2 956 georeferenced · 162 without coordinates
Open the mapobservation + sensor3 118
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 345≤1 km 301≤10 km 477>10 km 85
1 208 georeferenced · 1 047 without coordinates
Open the institutions mapphysical evidence2 255
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions72 of 141 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Adelaide, AU | 334 |
| Museo Entomologico de Leonlocation not on record | 211 |
| Auckland, NZ | 189 |
| Mount Annan, AU | 141 |
| Olocation not on record | 100 |
| Kensington, AU | 98 |
| Canberra, AU | 94 |
| Wellington, NZ | 75 |
| Kew, GB | 64 |
| Saint Louis, US | 64 |
| Hobart, AU | 60 |
| Palmerston, AU | 43 |
| Christchurch, NZ | 42 |
| UChlocation not on record | 38 |
| Brisbane, AU | 33 |
| Córdoba, AR | 32 |
| Corrientes, AR | 28 |
| Bronx, US | 26 |
| Armidale, AU | 22 |
| San Isidro, AR | 21 |
| Pretoria, ZA | 17 |
| Blumenau, BR | 16 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 16 |
| University of Stellenboschlocation not on record | 12 |
| Rotorua, NZ | 12 |
| Yaoundé, CM | 11 |
| Herbarium of South China Botanical Gardenlocation not on record | 11 |
| Puerto Ayora, EC | 11 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 11 |
| MeiseBGlocation not on record | 10 |
| Uppsala, SE | 9 |
| Valparaiso, CL | 9 |
| Universidad de Nariño (UdeNar)location not on record | 8 |
| Universidad Nacional de Colombia (UNAL)location not on record | 8 |
| Austin, US | 7 |
| Berlin, DE | 6 |
| Mexico City, MX | 6 |
| Culiacán, MX | 6 |
| Urumqi, CN | 6 |
| Chicago, US | 6 |
| La Paz, BO | 5 |
| Batemans Bay, AU | 5 |
| Servico de Microbiologia e Imunologialocation not on record | 5 |
| MAlocation not on record | 5 |
| National Biodiversity Institute, Costa Ricalocation not on record | 5 |
| BClocation not on record | 4 |
| EL PASO, US | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| WAGlocation not on record | 4 |
| Durango, MX | 4 |
| Parkville, AU | 4 |
| Paleontological Collectionlocation not on record | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 4 |
| BGPAlocation not on record | 4 |
| ASUlocation not on record | 3 |
| Paris, FR | 3 |
| Wlocation not on record | 3 |
| South Kensington, GB | 3 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 3 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 3 |
| NSW Office of Environment and Heritagelocation not on record | 3 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 3 |
| Kyoto Universitylocation not on record | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| Castelar, AR | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 3 |
| Plocation not on record | 2 |
| Frankfurt am Main | 2 |
| Chongqing Museumlocation not on record | 2 |
| JBRJlocation not on record | 2 |
| Campo Mourão, BR | 2 |
| Durban, ZA | 2 |
| National Museums of Kenyalocation not on record | 2 |
| GMBAlocation not on record | 2 |
| Austin, US | 2 |
| Chapingo, MX | 2 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 2 |
| QVMAGlocation not on record | 2 |
| Clocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| BMlocation not on record | 2 |
| Guatemala City, GT | 2 |
| Wollongong, AU | 2 |
| UTFPR-CPlocation not on record | 2 |
| Sucre, BO | 2 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| UFSClocation not on record | 2 |
| Helsinki, FI | 2 |
| Nunoa, Santiago, CL | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Provo, US | 1 |
| Nanjing, CN | 1 |
| Pelotas, BR | 1 |
| Cochabamba, BO | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| Cambridge, US | 1 |
| Universidad de Autonoma de Baja Californialocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| BRLUlocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| Beijing, CN | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| LDlocation not on record | 1 |
| Alicante, ES | 1 |
| Addis Ababa, ET | 1 |
| Riobamba, EC | 1 |
| WTUlocation not on record | 1 |
| Fundacion Miguel Lillolocation not on record | 1 |
| Guangzhou, CN | 1 |
| Brasília, BR | 1 |
| UFESlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Philadelphia, US | 1 |
| Smithfield, AU | 1 |
| Londrina, BR | 1 |
| James Cook Townsvillelocation not on record | 1 |
| Edinburgh, GB | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Tampa, US | 1 |
| UNESP-RClocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Riverside, US | 1 |
| San Francisco, US | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Feira de Santana, BR | 1 |
| Görlitz, DE | 1 |
| Loja, EC | 1 |
| Institute of Botany, Ilia State Universitylocation not on record | 1 |
141 institutions · 2 112 of 2 255 vouchered records shown · 141 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Parietaria debilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.9 °C 15.6–17.9
Seasonal swing summer↔winter6.70 °C
Max temp (day)19.6 °C 18.3–20.7
Min temp (night)15.0 °C 12.2–16.2
Precipitation2.50 mm/mo 1.10–38.7
Air humidity66.5 % 53.2–70.9
Moisture balance-124 mm/mo
Vapour deficit682 Pa 535–913
Wind speed2.90 m/s
Cloud cover56.3 % 46.9–63.8
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.