Parietaria cretica

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Parietaria

At a glance

Occurrence records292

Data sources5

Biological traits6

DNA specimens1

eDNA detections0

Sources5 archives

Databases and archives Parietaria cretica's data was compiled from.

GBIFGlobal Biodiversity Information Facility292 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF292 records

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formannual or perennial

Lifeform raunkiaer detailedhemicryptophyte

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parietaria cretica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH317259.1 ↗408 bpGreece

ACGT

CGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGTCGTTAGGCTG …

Parietaria cretica voucher C. Braeuchler 2885 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type292 records

Wild obs. + sensor21

Museum / vouchered271

Range

Area of Occupancy AOO944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 8≤1 km 2≤10 km 3>10 km 1

14 georeferenced · 7 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 2≤1 km 6≤10 km 3

11 georeferenced · 260 without coordinates

Open the institutions mapphysical evidence271

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	202
Berlin, DE	23
BIO-UNIPIlocation not on record	14
Wlocation not on record	5
University of Patraslocation not on record	3
Saint Louis, US	3
Frankfurt am Main	3
Davis, US	2
BRNUlocation not on record	2
Tilburg, NL	2
Oskarshamn, SE	1
Salzburg, AT	1
Provincia di Livornolocation not on record	1
Moscow State Universitylocation not on record	1
Claremont, US	1
Barcelona, ES	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Paris, FR	1
Uppsala, SE	1
BClocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
GZUlocation not on record	1

22 institutions · 271 of 271 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)