Pardosa tesquorum

(Odenwall, 1901) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Pardosa

At a glance

Occurrence records239

Data sources9

Biological traits3

DNA specimens113

eDNA detections86

Sources9 archives

Databases and archives Pardosa tesquorum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics113 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF239 records

Environmental DNA1 datasets · 2 countries86 detections

DNA & barcodingBOLD113 specimens

01Narrative

Pardosa tesquorum is a spider in the genus Pardosa ("thinlegged wolf spiders"), in the family Lycosidae ("wolf spiders").bugguide.net Pardosa tesquorum species information.Encyclopedia of Life Pardosa tesquorum species overview. The distribution range of Pardosa tesquorum includes Russia, Mongolia, China, the US, and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀5.69·♂4.83 mm

Cephalothorax length♀2.55·♂2.39 mm

Cephalothorax width♀1.98·♂1.83 mm

05DNA & barcoding113 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pardosa tesquorum has left across the world's sequence archives.

At a glance

DNA specimens113

BINs5

Marker genes2

eDNA detections86

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus109 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

19Avariable

91Gmostly conserved

142Amostly conserved

157Avariable

163Gvariable

194Tvariable

217Tvariable

223Cvariable

238Gmostly conserved

265Avariable

283Amostly conserved

286Avariable

304Amostly conserved

394Cvariable

430Amostly conserved

463Amostly conserved

470Tvariable

526Gmostly conserved

538Avariable

559Avariable

625Amostly conserved

628Amostly conserved

TTTATATTTAATGTTTGGAGTTTGATCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATGGAATTAGGAAATCCTGGAAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes23

BINs5

Most divergent pair5.1%

N.AmericaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pardosa pseudolapponicasame genus2.9%Pardosa mulaikisame genus3.2%Pardosa atratasame genus3.4%Pardosa aenigmaticasame genus3.4%Pardosa cinctasame genus3.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type239 records

Wild obs. + sensor4

Museum / vouchered235

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 58≤1 km 16≤10 km 29>10 km 11

114 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence235

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	98
Denver, US	23
University of Alberta Museums (UAM)location not on record	17
Royal Saskatchewan Museumlocation not on record	17
IBPNlocation not on record	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
University of Tokyo, Department of Zoologylocation not on record	7
Cambridge, US	6
Chicago, US	6
CASlocation not on record	4
Vancouver, CA	4
Ekaterinburg, RU	3
Albuquerque, US	2
Swedish Museum of Natural History, Entomology Collectionslocation not on record	2
Helsinki, FI	1
University of Alaska Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
ISEAlocation not on record	1

18 institutions · 216 of 235 vouchered records shown · 19 without an institution code

09Environmental DNA86 detections

Where the DNA of Pardosa tesquorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found86

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 86 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 6.40–15.2

Seasonal swing summer↔winter36.5 °C

Max temp (day)17.4 °C 10.1–20.4

Min temp (night)9.60 °C 2.40–11.6

Precipitation95.5 mm/mo 43.4–175

Air humidity57.3 % 54.2–61.5

Moisture balance0 mm/mo -53.4–80.9

Vapour deficit674 Pa 376–741

Wind speed2.00 m/s 1.10–4.60

Cloud cover41.2 % 38.2–61.9

CHELSA 1981–2010, ~9 km grid, at location & month of 86 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)