Pardosa groenlandica

(Thorell, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Pardosa

At a glance

Occurrence records894

Data sources9

Biological traits3

DNA specimens320

eDNA detections97

Sources9 archives

Databases and archives Pardosa groenlandica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility894 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics320 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF894 records

Environmental DNA1 datasets · 2 countries97 detections

DNA & barcodingBOLD320 specimens

01Narrative

Pardosa groenlandica is a species of wolf spider in the family Lycosidae. It is found in Russia, Canada, the United States, and Greenland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀9.01·♂8.25 mm

Cephalothorax length♀4.08·♂4.12 mm

Cephalothorax width♀3.18·♂3.15 mm

05DNA & barcoding320 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pardosa groenlandica has left across the world's sequence archives.

At a glance

DNA specimens320

BINs3

Marker genes2

eDNA detections97

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus308 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

37Gvariable

40Avariable

55Amostly conserved

76Gmostly conserved

103Tmostly conserved

178Amostly conserved

181Tvariable

193Amostly conserved

211Amostly conserved

262Gvariable

301Avariable

307Amostly conserved

361Gmostly conserved

427Amostly conserved

436Amostly conserved

475Gmostly conserved

478Avariable

505Amostly conserved

523Amostly conserved

533Cvariable

535Amostly conserved

577Gmostly conserved

625Amostly conserved

TTTATATTTAATGTTTGGGGTTTGGTCAGCTATAATGGGAACTGCTATAAGAGTATTAATTCGAATGGAATTAGGGAATCCTGGAAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes25

BINs3

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pardosa furciferasame genus1.7%Pardosa labradorensissame genus1.8%Pardosa podhorskiisame genus1.8%Pardosa buckleisame genus1.8%Pardosa anomalasame genus2.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type894 records

Wild obs. + sensor25

Museum / vouchered869

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 15≤1 km 8

23 georeferenced · 2 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 299≤1 km 11≤10 km 32>10 km 3

345 georeferenced · 524 without coordinates

Open the institutions mapphysical evidence869

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	255
Denver, US	167
Chicago, US	139
University of Guelph, Centre for Biodiversity Genomicslocation not on record	76
AU-Biosciencelocation not on record	56
Cambridge, US	43
University of Alberta Museums (UAM)location not on record	10
BioFokuslocation not on record	5
Copenhagen, DK	4
WIlocation not on record	2
Vancouver, CA	2
Frankfurt am Main	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Chicago, US	1
McGill Universitylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

16 institutions · 765 of 869 vouchered records shown · 104 without an institution code

09Environmental DNA97 detections

Where the DNA of Pardosa groenlandica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map2 countries0

Bog1. Forest & Woodland | 1.1. Boreal ForestTundraMixed habitat4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 6.60–15.2

Seasonal swing summer↔winter26.9 °C

Max temp (day)17.4 °C 10.5–19.0

Min temp (night)8.30 °C 1.30–11.4

Precipitation119 mm/mo 66.3–175

Air humidity57.1 % 55.8–64.8

Moisture balance13.6 mm/mo -22.5–80.9

Vapour deficit621 Pa 344–735

Wind speed1.90 m/s 1.10–9.40

Cloud cover41.1 % 39.8–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)