Pardosa glacialis

(Thorell, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Pardosa

At a glance

Occurrence records117

Data sources9

Biological traits3

DNA specimens282

eDNA detections4

Sources9 archives

Databases and archives Pardosa glacialis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics282 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF117 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD282 specimens

01Narrative

The Arctic wolf spider (Pardosa glacialis) CanadianArachnology.org: Pardosa glacialis (Thorell, 1872)EOL: Pardosa glacialis (Thorell, 1872) is a type of wolf spider in the genus Pardosa, with a holarctic distribution and endemic to the Arctic, particularly Greenland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀7.28·♂6.4 mm

Cephalothorax length♀3.16·♂3.18 mm

Cephalothorax width♀2.47·♂2.44 mm

05DNA & barcoding282 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pardosa glacialis has left across the world's sequence archives.

At a glance

DNA specimens282

BINs1

Marker genes3

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus273 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

ACTTTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATGGAATTAGGGAATCCTGGTAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.07%

Haplotypes6

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pardosa septentrionalissame genus1.5%Pardosa tyshchenkoisame genus1.9%Pardosa wyutasame genus3.1%Pardosa sinistrasame genus3.1%Pardosa modicasame genus3.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3PCYTB

animal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type117 records

Wild obs. + sensor16

Museum / vouchered101

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 9≤1 km 1≤10 km 3>10 km 1

14 georeferenced · 2 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 4≤10 km 5

9 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	24
Denver, US	8
AU-Biosciencelocation not on record	4
Centre for Biodiversity Genomics, Informatics Departmentlocation not on record	4
University of Helsinkilocation not on record	1
Copenhagen, DK	1

6 institutions · 42 of 101 vouchered records shown · 59 without an institution code

09Environmental DNA4 detections

Where the DNA of Pardosa glacialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.5 °C 10.2–10.9

Seasonal swing summer↔winter31.3 °C

Max temp (day)14.6 °C 14.2–15.0

Min temp (night)6.50 °C 6.20–6.80

Precipitation51.2 mm/mo 43.7–58.6

Air humidity54.0 % 53.6–54.5

Moisture balance-52.0 mm/mo -62.9–-41.1

Vapour deficit584 Pa 565–603

Wind speed3.50 m/s 2.90–4.00

Cloud cover33.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)