Pardosa distincta

(Blackwall, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Pardosa

At a glance

Occurrence records1 519

Data sources9

Biological traits3

DNA specimens170

eDNA detections165

Sources9 archives

Databases and archives Pardosa distincta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 519 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI165 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics170 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF1 519 records

Environmental DNA1 datasets · 2 countries165 detections

DNA & barcodingBOLD170 specimens

01Narrative

Pardosa distincta is a species of wolf spider in the family Lycosidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀5.39·♂4.71 mm

Cephalothorax length♀2.49·♂2.43 mm

Cephalothorax width♀1.73·♂1.66 mm

05DNA & barcoding170 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pardosa distincta has left across the world's sequence archives.

At a glance

DNA specimens170

BINs2

Marker genes1

eDNA detections165

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus168 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

4Amostly conserved

13Gmostly conserved

67Amostly conserved

166Amostly conserved

196Amostly conserved

226Avariable

466Amostly conserved

523Gvariable

526Avariable

TTTATATTTAATGTTTGGAGTTTGGTCAGCTATAGTAGGAACTGCTATAAGAGTATTAATTCGGATAGAATTAGGAAATCCTGGAAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes23

BINs2

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pardosa luctinosasame genus3.2%Pardosa xerophilasame genus3.2%Pardosa albatulasame genus3.4%Pardosa paludicolasame genus3.4%Pardosa sternalissame genus3.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 519 records

Wild obs. + sensor69

Museum / vouchered1 450

Range

Area of Occupancy AOO1 760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 37≤1 km 15≤10 km 1>10 km 7

60 georeferenced · 9 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 139≤1 km 17≤10 km 175>10 km 3

334 georeferenced · 1 116 without coordinates

Open the institutions mapphysical evidence1 450

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	548
Denver, US	499
Royal Saskatchewan Museumlocation not on record	125
WIlocation not on record	67
University of Guelph, Centre for Biodiversity Genomicslocation not on record	40
Chicago, US	38
Albuquerque, US	29
Biodiversity Institute of Ontariolocation not on record	10
Champaign, US	8
University of Alberta Museums (UAM)location not on record	4
US	4
München, DE	3
Edmonton, CA	2
Chicago, US	1
Espace pour la vielocation not on record	1
Ohio State University Acarology Laboratorylocation not on record	1
Saint John, CA	1
Centre for Biodiversity Genomicslocation not on record	1
Frankfurt am Main	1

19 institutions · 1 383 of 1 450 vouchered records shown · 67 without an institution code

09Environmental DNA165 detections

Where the DNA of Pardosa distincta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found165

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 165 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate ForestForestWetlandGrasslandMixed HabitatMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 12.0–20.9

Seasonal swing summer↔winter25.1 °C

Max temp (day)23.2 °C 18.8–27.7

Min temp (night)9.10 °C 5.50–13.2

Precipitation65.5 mm/mo 29.6–94.1

Air humidity53.2 % 49.1–56.7

Moisture balance-71.9 mm/mo -142–-15.6

Vapour deficit874 Pa 655–1,241

Wind speed2.40 m/s 2.20–3.80

Cloud cover39.0 % 29.9–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 165 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pardosa distincta

At a glance

Sources9 archives

Morphometry3

At a glance

Record type1 519 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 519 records