Paraulacizes irrorata

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Paraulacizes

At a glance

Occurrence records4 245

Data sources6

Biological traits0

DNA specimens15

eDNA detections15

Sources6 archives

Databases and archives Paraulacizes irrorata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility4 245 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 245 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Paraulacizes irrorata, the speckled sharpshooter, is a species of sharpshooter in the family Cicadellidae. Speckled sharpshooter, Paraulacizes irrorata They lay eggs in woody twigs, stems, or petioles, and their eggs can become infected by Gonatocerus fasciatus, which acts as a parasitoid.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paraulacizes irrorata has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 3 variable positions, in barcode order

337Gmostly conserved

340Tmostly conserved

409Gmostly conserved

AACTCTTTATTTCATCTTTGGTATTTGGTCAGGAATAGTAGGTATAATACTAAGACTAATTATTCGAATTGAATTAGCCCAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paraulacizes figuratasame genus12.9%Paracrocampsa aulaeatasame family14.0%Homalodisca insolitasame family14.1%Pseudometopia amblardiisame family14.3%Provancherana mollicellasame family16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type4 245 records

Wild obs. + sensor3 987

Museum / vouchered258

Range

Area of Occupancy AOO11 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 988≤1 km 606≤10 km 175>10 km 492

3 261 georeferenced · 726 without coordinates

Open the mapobservation + sensor3 987

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 10≤1 km 26≤10 km 60>10 km 1

97 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	91
Montgomery, US	66
North Carolina State University Insect Museumlocation not on record	41
University of Guelphlocation not on record	12
Wuzhou, CN	10
University of Delawarelocation not on record	9
University Park, US	5
College Station, US	4
Texas A&M University Insect Collectionlocation not on record	3
Cambridge, US	3
New Haven, US	3
Mississippi State, US	2
Museu Nacional de História Natural e da Ciêncialocation not on record	2
East Lansing, US	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
CUlocation not on record	1
Cornell University Insect Collectionlocation not on record	1

17 institutions · 256 of 258 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Paraulacizes irrorata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 22.1–25.8

Seasonal swing summer↔winter23.7 °C

Max temp (day)29.3 °C 26.7–30.6

Min temp (night)20.9 °C 16.3–22.1

Precipitation123 mm/mo 81.5–133

Air humidity58.1 % 56.0–60.4

Moisture balance-73.2 mm/mo -94.2–-48.5

Vapour deficit1,283 Pa 1,112–1,528

Wind speed4.00 m/s 2.60–4.80

Cloud cover33.6 % 28.5–37.4

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Paraulacizes irrorata

At a glance

Sources6 archives

At a glance

Record type4 245 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 245 records