Parastrephia lepidophylla

(Wedd.) Cabrera · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Parastrephia

At a glance

Occurrence records45

Data sources9

Biological traits7

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Parastrephia lepidophylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Chemical compositionLOTUS · NPASS150 compounds

Occurrence & distributionGBIF45 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Parastrephia lepidophylla, commonly known as tola or tola tola, is a species of flowering plant in the daisy family. It is native to South America and has been recorded from Argentina, Bolivia, Chile and Peru where it is characteristic of the puna grassland ecoregion. It is a resinous shrub, growing up to 2 m in height, that is typically found in semi-arid central Andean dry, or tola heath, puna habitats, at altitudes of 3500–5000 m above sea level, and in the undergrowth of central Andean Polylepis forest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition150 compounds

Compounds documented for Parastrephia lepidophylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Gallotannins39

Flavones6

Ursane and Taraxastane triterpenoids5

Cinnamic acids and derivatives4

Anthocyanidins4

Documented compounds150 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	NPASS
(10R,11R)-10-[(14R,15S,19R)-2,3,4,7,8,9,19-heptahydroxy-12,17-dioxo-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaen-14-yl]-3,4,5,11,17,18,19,22,23,34,35-undecahydroxy-9,13,25,32-tetraoxaheptacyclo[25.8.0.02,7.015,20.021,30.024,29.028,33]pentatriaconta-1(35),2,4,6,15,17,19,21,23,27,29,33-dodecaene-8,14,26,31-tetrone	present	NPASS
(10R,11R)-10-[(14S,15S,19R)-2,3,4,7,8,9,19-heptahydroxy-12,17-dioxo-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaen-14-yl]-3,4,5,11,16,17,18,21,22,33,34-undecahydroxy-9,24,31-trioxaheptacyclo[24.8.0.02,7.014,19.020,29.023,28.027,32]tetratriaconta-1(34),2,4,6,14,16,18,20,22,26,28,32-dodecaene-8,13,25,30-tetrone	present	NPASS
(10R,11R,13R,14R,15S)-3,4,5,11,14,20,21,22-octahydroxy-13-(hydroxymethyl)-9,12,16-trioxatetracyclo[16.4.0.02,7.010,15]docosa-1(22),2,4,6,18,20-hexaene-8,17-dione	present	NPASS
(1R,2S,4aS,6aR,6aS,6bS,8aS,10S,12aR,14bR)-10-hydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	NPASS
(1R,2S,8R,10R,19R,20S,39S)-8,9,9,13,14,25,26,27,30,31,32,39-dodecahydroxy-3,18,21,36,38,40-hexaoxaoctacyclo[18.17.1.12,19.18,12.05,10.011,16.023,28.029,34]tetraconta-5,11,13,15,23,25,27,29,31,33-decaene-4,7,17,22,35-pentone	present	NPASS
(1S,2R,4aS,6aR,6aS,6bR,8aS,9R,10R,11R,12aR,14bS)-10,11-dihydroxy-9-(hydroxymethyl)-1,2,6a,6b,9,12a-hexamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	NPASS
(2S)-2,5,7-trihydroxy-2-(4-hydroxyphenyl)-4H-chromen-3-one	present	NPASS
(2S)-2-(2,5-dihydroxy-4-methoxyphenyl)-5,6,8-trihydroxy-7-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	NPASS
(2S)-5,6,7,8-tetrahydroxy-2-(2,3,5-trihydroxy-4-methoxyphenyl)-2,3-dihydrochromen-4-one	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parastrephia lepidophylla has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSDQ479019.1 ↗631 bp

ACGT

TCGAAGCCTGCAAAGCAAAACGACCCGCGAACATGTTATAACAACCATGCCAGGATGGGTCGGGCGTTAGTTCGATCCTTGTGGCACACC …

Parastrephia lepidophylla voucher J. Treacy 822 (F) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

08Occurrence & distribution

Record type45 records

Wild obs. + sensor29

Museum / vouchered16

Origin

Native15

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 19≤1 km 1≤10 km 3

23 georeferenced · 6 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 16 records without

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	2
Chicago, US	2
University of Stellenboschlocation not on record	2
Edinburgh, GB	2
Cochabamba, BO	2
Pelotas, BR	1
Córdoba, AR	1
Saint Louis, US	1

8 institutions · 13 of 16 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Parastrephia lepidophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)