Parashorea malaanonan

(Blanco) Merr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Dipterocarpaceae/Parashorea

At a glance

Occurrence records214

Data sources10

Biological traits16

DNA specimens12

eDNA detections6

Sources10 archives

Databases and archives Parashorea malaanonan's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.36 Gbp↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF214 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceGoaT362 Mbp

01Narrative

Parashorea malaanonan is a species of plant in the family Dipterocarpaceae. it is found in the Philippines and the northeast coast of Sabah in Borneo. The name malaanonan is derived from Tagalog (mala = false and anonang = custard apple) and is a putative vernacular name for this species. It is a large emergent tree, up to 60 m, found in mixed dipterocarp forests on deep friable clay soils. It can still be found in forest reserves in the east coast of Sabah although elsewhere it is threatened by habitat loss. The timber is a light hardwood sold under the trade name of white lauan or white seraya.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height50 m

⚠ sources differ — GIFT: 50 m · TRY: 27.46 m

Seed mass1 784 mg

Seed mass max1 860 mg

Seed mass min1 860 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry5

Leaf n19.04 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)19.21 mm²/mg

Wood density703 mg/cm³

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parashorea malaanonan has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes3

GenBank sequences5

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMZ782451.1 ↗5 791 bp

ACGT

TCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCATTAAATCAGTTA …

Parashorea malaanonan voucher BGT4386 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Parashorea malaanonan carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size361 860 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Parashorea malaanonan0.36 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type214 records

Wild obs. + sensor44

Museum / vouchered132

Cultivated / captive38

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 41 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 132 records without

Open the institutions mapphysical evidence132

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 38 records without

Open the mapnot free-living38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	6
Universiti Brunei Darussalam, Herbariumlocation not on record	5
Kew, GB	1

3 institutions · 12 of 132 vouchered records shown · 120 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Parashorea malaanonan was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.3 °C 26.3–26.3

Seasonal swing summer↔winter1.10 °C

Max temp (day)30.1 °C

Min temp (night)22.8 °C

Precipitation330 mm/mo

Air humidity69.8 %

Moisture balance183 mm/mo

Vapour deficit1,035 Pa

Wind speed0.9 m/s

Cloud cover48.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)