Paraquilegia caespitosa — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Paraquilegia

At a glance

Occurrence records39

Data sources5

Biological traits9

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Paraquilegia caespitosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF39 records

DNA & barcodingNCBIsequences

01Narrative

Die Rasenbildende Paraquilegia (Paraquilegia caespitosa) ist eine Pflanzenart aus der Familie der Hahnenfußgewächse (Ranunculaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Flowering endJun

Flowering startJun

Life formperennial

Life spanperennial

Habitat & environment4

Climatesubalpine or subarctic

Growth formherb

Habitat GIFTmountains, stony places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paraquilegia caespitosa has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSPQ144399.1 ↗607 bp

ACGT

TCGAAACCTGCTCAAAGCAGCACGACCCGCGAACACGTGAAAACAACTCCGTTGGGGACCGGGGAGGGGCGCGAGCCCCCGACCGACCCC …

Paraquilegia caespitosa voucher Yi L s.n. (PE) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL2ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type39 records

Wild obs. + sensor10

Museum / vouchered29

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 3≤10 km 1

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	12
Academy of Sciences of the Republic of Uzbekistanlocation not on record	10
Urumqi, CN	5
Uniwersytet Opolskilocation not on record	1
Edinburgh, GB	1

5 institutions · 29 of 29 vouchered records shown