Paraquilegia anemonoides

(Willd.) Engl. ex Ulbr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Paraquilegia

At a glance

Occurrence records263

Data sources8

Biological traits21

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Paraquilegia anemonoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF263 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

01Narrative

乳突拟耧斗菜（学名：）为毛茛科拟耧斗菜属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length11 mm

Fruit length max12 mm

Fruit length min10 mm

Plant height max0.25 m

Life cycle & reproduction5

Flowering endJun

Flowering startJun

Life formperennial

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Elevation max4 900 m

Elevation mean3 000 m

Elevation min2 600 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, mountains, rivers, stony places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paraquilegia anemonoides has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences8

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMT363633.1 ↗218 bp

ACGT

CGCACAGCGTCGCCCCCAACCGCACATGTTGTGGGAGGGGAGCGGAGATTGGCCCCCCGAGCCCCTACGGGGCACGGTCGGCACAAATGC …

Paraquilegia anemonoides internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Paraquilegia anemonoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — llelaeva & Siplivinsky 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.488 ↗

08Occurrence & distribution

Record type263 records

Wild obs. + sensor67

Museum / vouchered159

Cultivated / captive7

Other30

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 19≤1 km 4≤10 km 16>10 km 7

46 georeferenced · 21 without coordinates

Open the mapobservation + sensor67

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 1≤10 km 22>10 km 14

37 georeferenced · 122 without coordinates

Open the institutions mapphysical evidence159

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GMBAlocation not on record	37
Moscow State Universitylocation not on record	33
Beijing, CN	25
Yangling, CN	17
Xining, CN	11
Urumqi, CN	9
Kunming, CN	6
WNNUlocation not on record	4
Uniwersytet Opolskilocation not on record	4
Beijing Normal Universitylocation not on record	3
Cambridge, US	2
Chengdu, CN	2
Edinburgh, GB	2
Academy of Sciences of the Republic of Uzbekistanlocation not on record	1
Guilin, CN	1
Claremont, US	1
Nanjing, CN	1

17 institutions · 159 of 159 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Paraquilegia anemonoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)