Parapholis incurva
(L.) C.E.Hubb. · speciesAt a glance
Occurrence records11 964
Data sources10
Biological traits55
DNA specimens23
eDNA detections16
Sources10 archives
Databases and archives Parapholis incurva's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility11 964 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics23 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources55 traits
Occurrence & distributionGBIF11 964 records
Environmental DNA1 datasets · 5 countries16 detections
DNA & barcodingBOLD · NCBI23 specimens
Genome at a glanceCCDB8.9 Gbp
01Narrative
Parapholis incurva is a species of grass native to Europe, Asia and northern Africa, and widely naturalised elsewhere. Common names include coast barbgrass, curved sea hard grass, curved hard-grass, sicklegrass, curved sicklegrass and curved parapholis.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTAusTraitsWCVP
Size & morphology20
Inflorescence length max14.0 cm
Leaf length60 mm
Leaf length max80 mm
Leaf length min10 mm
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · AusTraits: 819 mm²
Leaf width1.7 mm
⚠ sources differ — AusTraits: 1.7 mm · GIFT: 1 mm
Leaf width max2.5 mm
Leaf width min1 mm
Plant height0.12 m
⚠ sources differ — GIFT: 0.12 m · AusTraits: 0.25 m · TRY: 0.092 m
Plant height max0.35 m
Plant height min0.04 m
Seed length3 mm
Seed length max3 mm
Seed length min3 mm
Seed mass2.34 mg
Seed mass max2.62 mg
Seed mass min2.06 mg
Seed width0.8 mm
Seed width max0.8 mm
Seed width min0.8 mm
Life cycle & reproduction14
Dispersal type detailedanemochorous
Flower colourwhite
Flower length max4.5 mm
Flower length min3 mm
Flowering endJun
Flowering startMar
Flowering timennnnnnnnyyyn
Life formannual
Life spanannual
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Sex typemonoecious
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb
Habitat GIFTmountains, sand
Leaf compoundnesssimple
Leaf shapesubulate
Mycorrhizaabsent
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits3
Inflorescencespike
Plant support typefree-standing
Shoot orientationascending
05DNA & barcoding23 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parapholis incurva has left across the world's sequence archives.
At a glance
DNA specimens23
Marker genes5
GenBank sequences10
eDNA detections16
Countries7
The DNA barcodea real sequence read deposited for this species
GTTGCGCCCGAGGCCTTTTGGCTAAGGGCACGCCTGCCTGGGCGTCACGCAAAACACGCTCACAACCCATAACCTAGGTTGTGACGCGGC …
Parapholis incurva voucher CCDB-24911-B09 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Parapholis incurva carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size8 899 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Parapholis incurva8.9 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 38 n = 19
Ploidypolyploid inferred
Chromosome records14–422n range38median38mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3815×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +6
CCDB · ita-fl — SCRUGLI A., BOCCHIERI E. - 1976. NUmeri cromosomici per la flora italiana:263-269.. Inform. Bot. Ital. , 8(2): 216-223.
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 77-103(1973).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 2 Queirs, M.Bol. Soc. Brot. ser. 248: 81-98(1974).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · fl-europaea — Fernandes I5 Queiros
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · eflora
CCDB · book-fedorov — Runemark 1962
CCDB · book-atlas-flowering-plants — Rodrigues 1953
CCDB · Cave1962 — Runemark 1962
CCDB · CromoCat 2015 — Runemark, H. (1962). A revision of Parapholis and Monerma in the Mediterranean. Bot. Not. 115: 1-17.
CCDB · CromoCat 2015 — Scrugli, A. & E. Bocchieri. (1976). Numeri cromosomatici per la Flora Italiana: 263-269. Inf. Bot. Ital. 8: 216-223.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Queirós, M. (1973a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. I. Gramineae, supl. 1. Bol. Soc. Brot. 47: 77-103.
CCDB · CromoCat 2015 — Queirós, M. (1974a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. I. Gramineae, supl. 2. Bol. Soc. Brot. 48: 81-98.
2n 369×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · ipcn-api-dl — Sokolovskaya, A. P. & N. S. Probatova. 1979. Chromosome numbers of some grasses (Poaceae) in the U.S.S.R. flora. III. Bot. Zhurn. 64 (9): 1245–1258.
CCDB · book-ipcn67-71 — GOULD, F.W. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.
CCDB · book-indian_vol2 — Hubbard, C.E. 1954; Gould, J!I.W. 1970
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Tischler, G. 1934
CCDB · book-indian_vol2 — Parodi, L.R. 1946
CCDB · book-fedorov — Hubbard 1954
CCDB · book-atlas-flowering-plants — Avdulov 1931
CCDB · CromoCat 2015 — Gould, F. W. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXV]. Taxon 19(1): 104-105.
2n 422×CCDB · book-indian_vol2 · CCDB · book-fedorov
CCDB · book-indian_vol2 — Gould, F.W. 1'51
CCDB · book-fedorov — Gould 1958.
2n 141×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Labadie 1976a
2n 281×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dj spermatophyta de Portugal. I. Gramineae, Supl. I. Bol. Soc. Brot. I 4 7 ( Ser . 2 ) : 7 7- 1 0 3 .
2n 331×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Runemark, H. 1962 ; F11rnandes, A. & Queiros, M. 1969
n 1910×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · iber-fl — Aportacin al estudio cariolgico de las Gramineas espaolas. Talavera, S.Lagascalia7(2): 133-142(1978).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 696-707. Gallego, M. J. & S. Talavera.Anales Jard. Bot. Madrid51: 280(1994).
CCDB · ipcn-api-dl — Gallego, M. J. & S. Talavera. 1994. Nǔmeros cromosomăticos de plantas occidentales, 696--707. Anales Jard. Bot. Madrid 51(2): 280.
CCDB · ipcn-api-dl — Talavera, S. 1978. Aportacion al estudio cariologico de las gramineas espanolas. Lagascalia 7: 133–142.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Spies, J.J., S.M.C. Van Wyk, I.C. Nieman & E.J.L. Liebenberg (1997). Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 3. The Tribe Poeae Bothalia 27:75-82
CCDB · CromoCat 2015 — Talavera, S. (1978a). Aportación al estudio cariológico de las Gramineas españolas. Lagascalia 7(2): 133-142.
CCDB · CromoCat 2015 — Gallego, M. J. & Talavera, S. (1994). Números cromosomáticos de plantas occidentales, 696-707. Anales Jard. Bot. Madrid 51(2): 280.
n 215×CCDB · ipcn-api-dl · CCDB · Cave1958 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Spies, J. J., T. H. Burger & S. M. C. v. Wyk. 1999. Chromosome studies on African plants. 12. The tribes of subfamily Pooideae. Bothalia 29(2): 335–341.
CCDB · Cave1958 — Gould 1958
CCDB · CromoCat 2015 — Gould, F. W. (1958). Chromosome numbers in southwestern grasses. Amer. J. Bot. 45: 757-768.
CCDB · CromoCat 2015 — Spies, J. J., T. H. Burger & S. M. C. van Wyk (1999). Chromosome studies on African plants. 12. The tribes of subfamily Pooideae Bothalia 29(2): 335-341
CCDB · CromoCat 2015 — Spies, J.J., S.M.C. Van Wyk, I.C. Nieman & E.J.L. Liebenberg (1997). Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 3. The Tribe Poeae Bothalia 27:75-82
n 124×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). I. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 29-66(1990).
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, R. Tormo, A. Muñoz, M. C. Viera, J. Carrasco, A. Ortega & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., sér. 2 63: 153–205.
CCDB · CromoCat 2015 — Devesa, J.A., Ruiz, T., Tormo, R., Muñoz, A., Viera, M. C., Carrasco, J., Ortega, A. & Pastor, J. (1990). Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., Sér. 2 63:153-205
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990b). Contribucion al conocimiento cariológico de las Paoceae en Extremadura (España). I. Bol. Soc. Brot. 63: 29-66.
n 71×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Spies, J.J., S.M.C. Van Wyk, I.C. Nieman & E.J.L. Liebenberg (1997). Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 3. The Tribe Poeae Bothalia 27:75-82
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~8.26 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin8.26 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type11 964 records
Wild obs. + sensor8 717
Museum / vouchered3 067
Cultivated / captive7
Other173
Origin
Native914
Introduced1 873
Range
Area of Occupancy AOO22 268 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy47% within 1 km
≤100 m 2 349≤1 km 1 252≤10 km 3 894>10 km 146
7 641 georeferenced · 1 076 without coordinates
Open the mapobservation + sensor8 717
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy60% within 1 km
≤100 m 328≤1 km 719≤10 km 654>10 km 51
1 752 georeferenced · 1 315 without coordinates
Open the institutions mapphysical evidence3 067
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 1
1 georeferenced · 6 without coordinates
Open the mapnot free-living7
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions92 of 157 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Adelaide, AU | 318 |
| LDlocation not on record | 183 |
| Museo Entomologico de Leonlocation not on record | 157 |
| BIO-UNIPIlocation not on record | 137 |
| Santa Barbara, US | 106 |
| BClocation not on record | 95 |
| Canberra, AU | 85 |
| Claremont, US | 84 |
| Kensington, AU | 83 |
| Mount Annan, AU | 82 |
| Davis, US | 76 |
| San Diego, US | 75 |
| Hobart, AU | 75 |
| València, ES | 72 |
| Auckland, NZ | 67 |
| Barcelona, ES | 60 |
| BDBClocation not on record | 57 |
| NSMKlocation not on record | 56 |
| MAlocation not on record | 50 |
| Berlin, DE | 42 |
| Pretoria, ZA | 39 |
| UIBlocation not on record | 35 |
| Wellington, NZ | 34 |
| Riverside, US | 33 |
| Christchurch, NZ | 31 |
| US | 29 |
| Brisbane, AU | 27 |
| Wlocation not on record | 24 |
| Moscow State Universitylocation not on record | 21 |
| Vitoria, ES | 20 |
| South Kensington, GB | 19 |
| San Isidro, AR | 19 |
| Entomological Society of Latvialocation not on record | 17 |
| Alicante, ES | 17 |
| Badajoz, ES | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 16 |
| University of Stellenboschlocation not on record | 16 |
| Logan, US | 16 |
| Salamanca, ES | 16 |
| San Luis Obispo, US | 15 |
| Cape Town, ZA | 15 |
| Canadian Department of Agriculturelocation not on record | 14 |
| Kew, GB | 14 |
| CJBGlocation not on record | 14 |
| Phyletisches Museum Jenalocation not on record | 13 |
| Dresden, DE | 13 |
| Córdoba, ES | 12 |
| Odawara, JP | 11 |
| Granada, ES | 10 |
| College of the Atlantic, Museumlocation not on record | 10 |
| Arcata, US | 10 |
| GJOlocation not on record | 10 |
| WTUlocation not on record | 10 |
| Saint Louis, US | 9 |
| CICYTEXlocation not on record | 9 |
| National Marine Biodiversity Institute of Korealocation not on record | 9 |
| Sevilla, ES | 9 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 9 |
| Pamplona, ES | 9 |
| Jaén, ES | 8 |
| Corvallis, US | 8 |
| Long Beach, US | 6 |
| Pamplona, ES | 6 |
| Frankfurt am Main | 6 |
| Severin-McDaniel Insect Collectionlocation not on record | 6 |
| Parkville, AU | 6 |
| John T. Waterhouse Herbariumlocation not on record | 6 |
| CASlocation not on record | 6 |
| Bloomington, US | 5 |
| Armidale, AU | 5 |
| Angwin, US | 5 |
| Pullman, US | 5 |
| Austin, US | 5 |
| Rotorua, NZ | 5 |
| Ciudad Autónoma de Buenos Aires, AR | 5 |
| Kawasaki Shi Tama Ku, JP | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Columbia, US | 5 |
| Bronx, US | 5 |
| Madrid, ES | 5 |
| Durban, ZA | 5 |
| Los Angeles, US | 4 |
| Bourges, FR | 4 |
| Santa Cruz, US | 4 |
| Fort Worth, US | 4 |
| Irvine, US | 4 |
| Provincia di Livornolocation not on record | 4 |
| J.F.Oberlin Universitylocation not on record | 4 |
| MeiseBGlocation not on record | 3 |
| The University of Arizonalocation not on record | 3 |
| Castelar, AR | 3 |
| Coimbra, PT | 3 |
| Palmerston, AU | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Mexico City, MX | 3 |
| Northridge, US | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| EL PASO, US | 3 |
| Boise, US | 3 |
| BGPAlocation not on record | 2 |
| QVMAGlocation not on record | 2 |
| Sanda, JP | 2 |
| Nanjing, CN | 2 |
| Universität Göttingenlocation not on record | 2 |
| GZUlocation not on record | 2 |
| OLAlocation not on record | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| Tsukuba, JP | 2 |
| Mexico City, MX | 2 |
| BSBIlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| BRNUlocation not on record | 2 |
| Wuzhou, CN | 2 |
| Vancouver, CA | 2 |
| Beijing, CN | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| San Jose, US | 2 |
| Chongqing Museumlocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| JBSlocation not on record | 1 |
| Monastir, TN | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| nlocation not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| US | 1 |
| EEZA-CSIClocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Moscow, US | 1 |
| PRClocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Batemans Bay, AU | 1 |
| La Trobe Universitylocation not on record | 1 |
| Sagamihara, JP | 1 |
| College Park, US | 1 |
| Shanghai, CN | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Ashland, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Paris, FR | 1 |
| Torreón, MX | 1 |
| Zapopan, MX | 1 |
| Salzburg, AT | 1 |
| IPE-CSIClocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Taipei, TW | 1 |
| National Museum Waleslocation not on record | 1 |
| Xiamen, CN | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Flagstaff, US | 1 |
| Brussel, BE | 1 |
157 institutions · 2 890 of 3 067 vouchered records shown · 175 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Parapholis incurva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map5 countries0
Wetland vegetation with Persicaria amphibia,…Along compacted sandy path below elevated ma…Sandy ground on or near dunes, full sun, wit…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.3 °C 13.0–19.0
Seasonal swing summer↔winter11.8 °C
Max temp (day)18.2 °C 16.4–24.4
Min temp (night)12.3 °C 8.80–14.3
Precipitation44.1 mm/mo 21.9–108
Air humidity59.4 % 50.7–62.1
Moisture balance-36.8 mm/mo
Vapour deficit690 Pa 638–1,173
Wind speed3.30 m/s
Cloud cover39.0 % 24.2–45.4
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.