Paraphaeosphaeria pilleata

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Didymosphaeriaceae/Paraphaeosphaeria

At a glance

Occurrence records4

Data sources7

Biological traits0

DNA specimens1

eDNA detections3

Sources7 archives

Databases and archives Paraphaeosphaeria pilleata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 records

Environmental DNA2 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Paraphaeosphaeria pilleata is a species of fungus in the Lophiostomataceae family. The species fruits exclusively in the lower parts of the culms of the black needlerush (Juncus roemerianus). It is found on the Atlantic Coast of North Carolina.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paraphaeosphaeria pilleata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences6

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT529872.1 ↗555 bp

ACGT

GTATCTCTCGTAGGTGCGGTCGCGGCCCTCGGGGGTTCTCTCCCGGGTGGTAGGGGTAACACCCTCACGCGCCGCATTCCTGCATCCTTT …

Paraphaeosphaeria pilleata clone SF_596 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS6

fungal barcode

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	2

1 institutions · 2 of 4 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Paraphaeosphaeria pilleata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 18.6–19.4

Seasonal swing summer↔winter27.9 °C

Max temp (day)23.7 °C 22.0–25.4

Min temp (night)15.2 °C

Precipitation67.5 mm/mo 60.1–74.9

Air humidity58.4 % 57.4–59.4

Moisture balance-69.8 mm/mo -88.4–-51.1

Vapour deficit916 Pa 871–962

Wind speed3.70 m/s 2.90–4.50

Cloud cover35.0 % 31.6–38.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.