Parapercis haackei

(Steindachner, 1884) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Pinguipedidae/Parapercis

At a glance

Occurrence records1 591

Data sources8

Biological traits6

DNA specimens5

eDNA detections9

Sources8 archives

Databases and archives Parapercis haackei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 377 records↗

OBISOcean Biodiversity Information System214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 591 records

Environmental DNA2 datasets · 1 countries9 detections

DNA & barcodingBOLD5 specimens

01Narrative

Parapercis haackei, the wavy grubfish, is a fish species in the sandperch family, Pinguipedidae. It is found in the Eastern Indian Ocean around southern Western Australia and South Australia. This species reaches a length of 10.0 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max35 m

Depth min1 m

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parapercis haackei has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.33%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

217Gmostly conserved

499Gmostly conserved

565Cvariable

568Tmostly conserved

CCTCTATTTAATTTTTGGCGCTTGAGCCGCAATAGTGGGAACAGCTTTAAGCCTGCTCATTCGAGCAGAACTAAGTCAACCAGGTGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parapercis lineopunctatasame genus16.2%Parapercis rubromaculatasame genus16.4%Hemilutjanus macrophthalmossame order16.5%Cubiceps paradoxussame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 591 records

Wild obs. + sensor1 255

Museum / vouchered332

Other4

Origin

Native2

Range

Area of Occupancy AOO952 km²

Depth

0–200 m sunlit80

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 12.8 m · max 124 m · 80 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 222≤1 km 153≤10 km 13>10 km 10

398 georeferenced · 857 without coordinates

Open the mapobservation + sensor1 255

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 9≤1 km 62≤10 km 26>10 km 44

141 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence332

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	32
Western Australian Museumlocation not on record	31
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	30
Museums Victorialocation not on record	21
Australian National Fish Collectionlocation not on record	12
CSIRO Oceans and Atmospherelocation not on record	4
Natick, US	2
	2
Honolulu, US	1
University of California San Diegolocation not on record	1
Australian Museum, Sydneylocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1

12 institutions · 138 of 332 vouchered records shown · 3 without an institution code

09Environmental DNA9 detections

Where the DNA of Parapercis haackei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 14.2–19.5

Seasonal swing summer↔winter5.90 °C

Max temp (day)19.5 °C 17.0–20.3

Min temp (night)17.9 °C 11.5–18.7

Precipitation35.4 mm/mo 24.4–61.1

Air humidity61.8 % 54.6–62.7

Vapour deficit821 Pa 714–868

Cloud cover17.4 % 15.6–18.9

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Parapercis haackei

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Record type1 591 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 591 records