Parapercis gilliesii

(Hutton, 1879) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Pinguipedidae/Parapercis

At a glance

Occurrence records362

Data sources8

Biological traits4

DNA specimens11

eDNA detections11

Sources8 archives

Databases and archives Parapercis gilliesii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

OBISOcean Biodiversity Information System189 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS362 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

The yellow weaver, Parapercis gilliesii, is a sandperch, a species of marine fish in the genus Parapercis found only around New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length35 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability25

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parapercis gilliesii has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTCTACTTAATTTTTGGTGCTTGAGCCGCAATAATTGGTACTGCCCTAAGCCTTCTCATTCGGGCCGAACTCGGTCAGCCCGGAGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parapercis allportisame genus3.0%Parapercis coliassame genus15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type362 records

Wild obs. + sensor330

Museum / vouchered32

Origin

Native3

Range

Area of Occupancy AOO700 km²

Depth

0–200 m sunlit108

200–1000 m twilight54

1–4 km midnight0

>4 km abyssal0

median 152 m · max 656 m · 162 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 324≤1 km 4≤10 km 2

330 georeferenced

Open the mapobservation + sensor330

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 9≤1 km 1≤10 km 1

11 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	3
Auckland, NZ	1

2 institutions · 4 of 32 vouchered records shown · 3 without an institution code

09Environmental DNA11 detections

Where the DNA of Parapercis gilliesii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.5 °C 11.5–14.2

Seasonal swing summer↔winter6.40 °C

Max temp (day)12.5 °C 12.5–15.0

Min temp (night)10.5 °C 10.5–13.3

Precipitation64.9 mm/mo 56.4–64.9

Air humidity60.8 % 60.8–62.8

Vapour deficit529 Pa 529–600

Cloud cover37.5 % 37.5–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)