Parapenaeus longirostris

(Lucas, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Penaeidae/Parapenaeus

At a glance

Occurrence records4 756

Data sources7

Biological traits8

DNA specimens38

eDNA detections38

Sources7 archives

Databases and archives Parapenaeus longirostris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 925 records↗

OBISOcean Biodiversity Information System2 831 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS4 756 records

Environmental DNA1 datasets · 6 countries38 detections

DNA & barcodingBOLD38 specimens

01Narrative

Parapenaeus longirostris est une espèce de crustacés décapodes ressemblant à une crevette. En Français, on peut les appeler «crevette rose du large», «Crevette tropicale profonde» ou simplement «Crevette rose»

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length16 cm

Life cycle & reproduction1

Max. longevity36 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max828 m

Depth min20 m

Vulnerability10

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parapenaeus longirostris has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes1

eDNA detections38

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BINs2

Most divergent pair16.5%

Where individuals differ — all 10 variable positions, in barcode order

22Tmostly conserved

25Tmostly conserved

91Tmostly conserved

220Amostly conserved

238Tmostly conserved

265Tmostly conserved

394Cmostly conserved

491Cmostly conserved

559Cmostly conserved

634Amostly conserved

TTTTATTTTCGGAGCTTGAGCTGGTATAGTAGGTACTGCTCTTAGATTAATCATTCGAGCTGAATTAGGTCAACCAGGTAGCTTAATTGG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parapenaeus indicussame genus11.5%Parapenaeus fissuroidessame genus11.6%Parapenaeus ruberoculatussame genus11.8%Parapenaeus australiensissame genus11.8%Parapenaeus sextuberculatussame genus12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 756 records

Wild obs. + sensor2 194

Museum / vouchered1 735

Other827

Origin

Native45

Range

Area of Occupancy AOO7 916 km²

Depth

0–200 m sunlit1 104

200–1000 m twilight1 394

1–4 km midnight3

>4 km abyssal0

median 221 m · max 1 803 m · 2 501 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 11≤1 km 190≤10 km 17>10 km 11

229 georeferenced · 1 965 without coordinates

Open the mapobservation + sensor2 194

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 101≤1 km 153≤10 km 5>10 km 38

297 georeferenced · 1 438 without coordinates

Open the institutions mapphysical evidence1 735

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICATMARlocation not on record	671
Washington, US	179
Brussels, BE	55
Alabama Museum of Natural Historylocation not on record	53
Texas Cooperative Wildlife Collectionlocation not on record	44
Museu Nacional de História Natural e da Ciêncialocation not on record	43
Universidade de Lisboa, Museu Bocagelocation not on record	36
RBINS-Scientific Heritagelocation not on record	35
College Station, US	33
IEOlocation not on record	32
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	29
UM-RSMASlocation not on record	22
AUTHlocation not on record	21
ICM-CSIClocation not on record	19
IPMAlocation not on record	15
Turkmen Agricultural University named after S.A. Niyazovlocation not on record	13
IEO-COMA-CSIClocation not on record	10
Cambridge, US	10
South Kensington, GB	6
New Haven, US	3
Frankfurt am Main	3
Paris, FR	1
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
Montgomery, US	1
	1
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	1
FCMMlocation not on record	1
IHSMlocation not on record	1

28 institutions · 1 339 of 1 735 vouchered records shown · 7 without an institution code

09Environmental DNA38 detections

Where the DNA of Parapenaeus longirostris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map6 countries0

Marine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 13.0–22.6

Seasonal swing summer↔winter12.1 °C

Max temp (day)19.9 °C 13.9–27.6

Min temp (night)14.2 °C 10.5–19.6

Precipitation10.9 mm/mo 0.1–48.4

Air humidity59.0 % 44.0–70.8

Vapour deficit792 Pa 591–1,628

Cloud cover34.1 % 14.2–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Parapenaeus longirostris

At a glance

Sources7 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type4 756 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 756 records