Paramuricea clavata

(Risso, 1827) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Malacalcyonacea/Paramuriceidae/Paramuricea

At a glance

Occurrence records8 781

Data sources12

Biological traits1

DNA specimens24

eDNA detections1

Sources12 archives

Databases and archives Paramuricea clavata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 993 records↗

OBISOcean Biodiversity Information System1 788 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF · OBIS8 781 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD24 specimens

Genome at a glanceGoaT · NCBI≈607 Mbp

01Narrative

Paramuricea clavata, the violescent sea-whip, is a species of colonial soft coral in the family Plexauridae. It is found in shallow seas of the north-eastern Atlantic Ocean and the north-western Mediterranean Sea as well as Ionian Sea. This species was first described by the French naturalist Antoine Risso in 1826.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

03Chemical composition30 compounds

Compounds documented for Paramuricea clavata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple indole alkaloids10

Purine alkaloids6

Iridoids monoterpenoids6

Carboline alkaloids2

Aminoacids2

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
1,3,7-Trimethylisoguanine	present	LOTUS
2-(6-bromo-1H-indol-3-yl)-N-methylethanamine	present	LOTUS
2-Bromo-N-methyltryptamine	present	LOTUS
3,7-Dimethylisoguanine	present	LOTUS
3-Bromo-N-methyltyramine	present	LOTUS
6-Hydroxy-1,2,3,4-tetrahydro-beta-carboline	present	LOTUS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1S,4S,8R,10S,11S,14S)-11-ethyl-12-oxo-7,9,13-trioxatetracyclo[6.5.1.01,10.04,14]tetradeca-2,5-diene-5-carboxylate	present	NPASS
AFYIWKNGSIYXCQ-DJFIYHCTSA-N	present	NPASS
AFYIWKNGSIYXCQ-NABKBDOTSA-N	present	NPASS
Bufotenin	present	LOTUS

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paramuricea clavata has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P581 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.94%

Haplotypes2

BIN1

Most divergent pair1.0%

Where individuals differ — all 6 variable positions, in barcode order

163Avariable

202Cvariable

250Gvariable

407Tvariable

433Gvariable

544Tvariable

TGCTTTTTCTGGGATGGCGGGAACAGCTTCAAGTATGTTAATACGGCTAGAACTGTCAGCCCCAGGTAGTATGTTAGGAGATGATCATCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paramuricea macrospinasame genus2.6%Paramuricea biscayasame genus2.8%Paramuricea placomussame genus2.9%Heterogorgia verrucosasame family4.1%Thrombophyton coronatumsame family4.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_034749 ↗ · 14 protein · 1 tRNA · 2 rRNA

COX1ND1CYTBND6ND3ND4LMUTSND2ND5ND4COX3ATP6ATP8COX2small subunit ribosomal RNAlarge subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Paramuricea clavata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈606 969 498 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Paramuricea clavata0.61 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type8 781 records

Wild obs. + sensor8 224

Museum / vouchered174

Cultivated / captive11

Other372

Origin

Native7

Range

Area of Occupancy AOO3 028 km²

Depth

0–200 m sunlit1 675

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 23.6 m · max 138 m · 1 675 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 506≤1 km 1 060≤10 km 648>10 km 11

2 225 georeferenced · 5 999 without coordinates

Open the mapobservation + sensor8 224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence174

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UB_ICMlocation not on record	136
AUTHlocation not on record	8
UCA - SOCIBlocation not on record	7
Institut Francais pour l'Etude de la Merlocation not on record	5
ICESlocation not on record	3
Banyoles, ES	2
Frankfurt am Main	2
Paris, FR	1

8 institutions · 164 of 174 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Paramuricea clavata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Paramuricea clavata

At a glance

Sources12 archives

Habitat & environment1

Compound class profile5 classes

Documented compounds30 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type8 781 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions3 of 8 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type8 781 records