Paramoltkia doerfleri

(Wettst.) Greuter & Burdet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Paramoltkia

At a glance

Occurrence records19

Data sources10

Biological traits5

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Paramoltkia doerfleri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 108

01Narrative

Paramoltkia doerfleri is a flowering plant native to Albania and southern parts of the former Yugoslavia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Plant height0.4 m

Life cycle & reproduction2

Deciduousnessdeciduous

Life formsubshrub

Habitat & environment2

Climatetemperate

Growth formHerbaceous

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paramoltkia doerfleri has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences7

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU044848.1 ↗269 bp

ACGT

TCGAAACCTGCGTAGCAGAACCACTCGCGAACATGTTTAAAAACTCAAGGCAATGGTCATAGTAGTAATACCTTGCTATTGACCAATGTC …

Paramoltkia doerfleri internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Paramoltkia doerfleri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 108 n = 54

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1081×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-

n 481×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — FOERNKRANZ, D. 1967. Einige neue Boraginaceen-Chromosomenzahlen. Oesterr. Bot. Zeits. 114: 341-345.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type19 records

Wild obs. + sensor4

Museum / vouchered15

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	12
Phyletisches Museum Jenalocation not on record	1

2 institutions · 13 of 15 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Paramoltkia doerfleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter20.0 °C

Max temp (day)20.1 °C

Min temp (night)9.70 °C

Precipitation104 mm/mo

Air humidity57.4 %

Moisture balance14.6 mm/mo

Vapour deficit848 Pa

Wind speed1.70 m/s

Cloud cover37.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)