Paralepistopsis acromelalga

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Tricholomataceae/Paralepistopsis

At a glance

Occurrence records0

Data sources8

Biological traits0

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Paralepistopsis acromelalga's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS22 compounds

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Paralepistopsis acromelalga is a basidiomycete fungus in the Tricholomataceae family. It was formerly classified as Clitocybe acromelalga.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition22 compounds

Compounds documented for Paralepistopsis acromelalga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aminoacids15

Pyridine alkaloids4

Imidazole alkaloids1

Dipeptides1

Aminoacids $ Dipeptides1

Documented compounds22 total

Compound	Amount	Source
(2R)-2-[[(1R)-1-carboxy-2-phenylethyl]amino]pentanedioic acid	present	LOTUS
(2S)-2-amino-3-(6-hydroxypyridin-3-yl)propanoic acid	present	LOTUS
(alphaS)-alpha-Amino-6-carboxy-2-oxo-2H-pyran-4-propanoic acid	present	LOTUS
(S)-4-(2-Amino-2-carboxyethyl)-1H-pyrrole-2-carboxylic acid	present	LOTUS
2-amino-4-[[5-[2-carboxy-2-(trimethylazaniumyl)ethyl]-1H-imidazol-2-yl]sulfanyl]-3-hydroxybutanoate	present	LOTUS
3-cyano-L-alanine	present	LOTUS
4-[(2S)-2-amino-2-carboxyethyl]-6-oxo-1,6-dihydropyridine-2-carboxylic acid	present	LOTUS
4-Aminopyridine-2,3-dicarboxylic acid	present	LOTUS
5-[(2S)-2-amino-2-carboxyethyl]-6-oxo-1H-pyridine-2-carboxylic acid	present	LOTUS
5-[(3S,4S,5S)-5-carboxy-4-(carboxymethyl)pyrrolidin-3-yl]pyridine-2-carboxylic Acid	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paralepistopsis acromelalga has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAB301606.1 ↗671 bp

ACGT

AAGGATCATTATTGAATAAACTTGGTTGGGTTGTTGCTGGCTCTTAGGAGCAGGTGCACACCTGATAACCATTTTTAAACCACCTGTGCA …

Clitocybe acromelalga genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 25S rRNA, partial and complete sequence, strain: NBRC 30567

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

09Environmental DNA1 detections

Where the DNA of Paralepistopsis acromelalga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.