Paralepista flaccida

(Sowerby) Vizzini · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Tricholomataceae/Paralepista

At a glance

Occurrence records15 010

Data sources10

Biological traits0

DNA specimens17

eDNA detections545

Sources10 archives

Databases and archives Paralepista flaccida's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 010 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI545 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF15 010 records

Environmental DNA6 datasets · 21 countries545 detections

DNA & barcodingBOLD · NCBI17 specimens

01Narrative

Paralepista flaccida (also called Clitocybe flaccida, Clitocybe inversa, Lepista flaccida and Lepista inversa, or in English tawny funnel cap) is a species of mushroom found across the Northern Hemisphere. It is known to form fairy rings.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition3 compounds

Compounds documented for Paralepista flaccida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Purine nucleos(t)ides2

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
5-(Chloromethyl)-3-methylfuran-2(5H)-one	present	LOTUS
Adenosine	present	LOTUS
Clitocine	present	LOTUS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paralepista flaccida has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes3

GenBank sequences9

eDNA detections545

Countries21

The DNA barcodea real sequence read deposited for this species

ITSPX570976.1 ↗272 bpPoland · 2024

ACGT

TTATTGAATAAACTTGGTGGGTTGTTGCTGGCTTTTCGGAGCATGTGCACACCCAACCCATTGTTTTTCTCCACCTGTGCACCATTTGTA …

Paralepista flaccida clone SH1551968.08FU_UDB015794 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS9★ITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type15 010 records

Wild obs. + sensor14 545

Museum / vouchered370

Other95

Range

Area of Occupancy AOO26 276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 5 343≤1 km 1 889≤10 km 6 662>10 km 77

13 971 georeferenced · 574 without coordinates

Open the mapobservation + sensor14 545

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 61≤1 km 109≤10 km 14>10 km 3

187 georeferenced · 183 without coordinates

Open the institutions mapphysical evidence370

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	72
Kew, GB	28
BDBClocation not on record	27
Helsinki, FI	24
Uniwersytet Łódzkilocation not on record	19
SLU Artdatabankenlocation not on record	15
LDlocation not on record	15
TROMlocation not on record	15
Vitoria, ES	10
Trondheim, NO	6
Kyiv, UA	5
University of Oslo, Natural History Museumlocation not on record	4
Staten Island, US	3
V. N. Karazin National Universitylocation not on record	3
NAlocation not on record	3
nsnflocation not on record	3
Kuopio, FI	3
Tromso University Museumlocation not on record	3
Toronto, CA	2
IB FRC Komi SC UB RASlocation not on record	2
WU-MYClocation not on record	2
Turku, FI	2
Philadelphia, US	2
Royal Botanic Gardens, Kewlocation not on record	1
TUR-Alocation not on record	1
WTUlocation not on record	1
Tartu, EE	1
Gijón, ES	1
Royal Ontario Museum, TRTC Fungariumlocation not on record	1
JA-CAGPDS-CAMlocation not on record	1
Santa Cruz, US	1
Copenhagen, DK	1
Vancouver, CA	1

33 institutions · 278 of 370 vouchered records shown · 92 without an institution code

09Environmental DNA545 detections

Where the DNA of Paralepista flaccida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found545

Studies independent surveys6

Countries21

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 545 detections have coordinates

Open the map21 countries0

PalearcticNeotropicHasselskog m bjÃ¸rk. Vokste under einerI olderskog.I lÃ¥gurtbjÃ¸rkeskog ovenfor bilveien.granskog

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 9.00–19.1

Seasonal swing summer↔winter19.9 °C

Max temp (day)18.8 °C 11.7–24.0

Min temp (night)12.1 °C 5.70–17.2

Precipitation75.7 mm/mo 35.1–157

Air humidity61.2 % 58.3–67.7

Moisture balance0.1 mm/mo

Vapour deficit714 Pa 406–866

Wind speed3.00 m/s

Cloud cover39.7 % 33.6–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 539 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Paralepista flaccida

At a glance

Sources10 archives

Compound class profile1 class

Documented compounds3 total

At a glance

Record type15 010 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type15 010 records