Paragyrodon sphaerosporus

(Peck) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Paxillaceae/Paragyrodon

At a glance

Occurrence records839

Data sources8

Biological traits0

DNA specimens4

eDNA detections532

Sources8 archives

Databases and archives Paragyrodon sphaerosporus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility839 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI532 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF839 records

Environmental DNA2 datasets · 2 countries532 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Paragyrodon is een monotypisch geslacht van schimmels behorend tot de familie Paxillaceae. Het bevat een soort, namelijk Paragyrodon sphaerosporus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paragyrodon sphaerosporus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences4

eDNA detections532

Countries2

The DNA barcodea real sequence read deposited for this species

ITSGU187540.1 ↗651 bpUSA · 2006

ACGT

CAGCAATCCGAAGGGGGAGAGGGGCGAGCGAAGTCGGGTGGAGCGTAGAGATCGTAGCTGGCCTTTGGAAACGAAGGCATGTGCACGTCT …

Paragyrodon sphaerosporus MB06-066 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type839 records

Wild obs. + sensor255

Museum / vouchered584

Range

Area of Occupancy AOO1 880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 124≤1 km 52≤10 km 27>10 km 25

228 georeferenced · 27 without coordinates

Open the mapobservation + sensor255

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 4≤10 km 25>10 km 5

34 georeferenced · 550 without coordinates

Open the institutions mapphysical evidence584

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	22
Chicago, US	17
Bronx, US	8
Denver, US	3
Bernard Price Institute for Palaeontological Researchlocation not on record	3
TENN-Flocation not on record	1
Ann Arbor, US	1
Helsinki, FI	1

8 institutions · 56 of 584 vouchered records shown · 528 without an institution code

09Environmental DNA532 detections

Where the DNA of Paragyrodon sphaerosporus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found532

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 532 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.1 °C 7.00–26.0

pH5.40 3.10–9.10

Conductivity57.4 µS/cm 6.00–2,000

Organic carbon2.13 % 0.004–6.24

Water content18.8 % 0.474–130

Nitrate-N6.00 mg/kg 0.145–233

Phosphorus13.0 mg/kg 1.00–483

Clay15.4 % 0.91–69.0

Sand66.2 % 8.81–97.1

Depth0 m 0–0.2

SoilDermosolSodosolKandosolTenosolsFerrosolRudosol

503 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 8.10–23.5

Seasonal swing summer↔winter12.0 °C

Max temp (day)19.7 °C 11.2–28.1

Min temp (night)9.50 °C 5.00–18.5

Precipitation68.6 mm/mo 33.1–135

Air humidity58.5 % 54.1–65.6

Moisture balance-28.9 mm/mo -120–58.3

Vapour deficit707 Pa 380–1,156

Wind speed2.90 m/s 1.70–4.50

Cloud cover24.1 % 9.50–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 528 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)