Paradiarsia punicea

Hübner · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Paradiarsia

At a glance

Occurrence records1 293

Data sources7

Biological traits0

DNA specimens11

eDNA detections11

Sources7 archives

Databases and archives Paradiarsia punicea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 293 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 293 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Paradiarsia punicea is a moth belonging to the family Noctuidae. The species was first described by Jacob Hübner in 1803. It is native to Eurasia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paradiarsia punicea has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

400Tmostly conserved

574Cmostly conserved

616Tmostly conserved

AACATTATATTTTATTTTCGGTATTTGAGCTGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGTGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Graphiphora augursame family4.3%Xestia c-nigrumsame family4.6%Netrocerocora quadrangulasame family4.7%Opigena polygonasame family4.9%Spaelotis havilaesame family4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 293 records

Wild obs. + sensor639

Museum / vouchered610

Other44

Origin

Native162

Range

Area of Occupancy AOO1 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 104≤1 km 108≤10 km 318>10 km 3

533 georeferenced · 106 without coordinates

Open the mapobservation + sensor639

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 108≤1 km 239≤10 km 225>10 km 7

579 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence610

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	95
Provincia di Livornolocation not on record	85
Tartu, EE	67
Salzburg, AT	60
Zürich, CH	59
Naturmuseum St. Gallenlocation not on record	39
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	34
Helsinki, FI	29
Bern, CH	16
SFRAlocation not on record	14
Geneva, CH	12
Tallinn, EE	11
Paro, BT	4
Archäologie und Museum Baselland - Museum.BLlocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
KIRMlocation not on record	4
Musee d'Histoire Naturallelocation not on record	3
Fribourg, CH	2
Universität Zürich, Naturhistorisches Museumlocation not on record	2
Winterthur, CH	2
Dhaka, BD	2
ZMAAlocation not on record	2
ZSMlocation not on record	1
Philadelphia, US	1
MZLUlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
EGBlocation not on record	1

27 institutions · 555 of 610 vouchered records shown · 55 without an institution code

09Environmental DNA11 detections

Where the DNA of Paradiarsia punicea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 5.00–17.6

Seasonal swing summer↔winter19.5 °C

Max temp (day)17.1 °C 7.30–21.6

Min temp (night)7.60 °C 2.20–12.5

Precipitation148 mm/mo 59.9–219

Air humidity62.5 % 61.5–64.7

Moisture balance49.5 mm/mo

Vapour deficit577 Pa 381–770

Wind speed2.30 m/s

Cloud cover41.3 % 36.1–55.5

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Paradiarsia punicea

At a glance

Sources7 archives

At a glance

Record type1 293 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 293 records