Paracorsia repandalis

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Paracorsia

At a glance

Occurrence records1 887

Data sources7

Biological traits0

DNA specimens34

eDNA detections34

Sources7 archives

Databases and archives Paracorsia repandalis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 887 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 887 records

Environmental DNA1 datasets · 9 countries34 detections

DNA & barcodingBOLD34 specimens

01Narrative

Paracorsia is a monotypic moth genus of the family Crambidae described by H. Marion in 1959. It contains only one species, Paracorsia repandalis, described by Michael Denis and Ignaz Schiffermüller in 1775. It is found in most of Europe, except Ireland, Fennoscandia and the Baltic region."Paracorsia repandalis (Denis & Schiffermüller, 1775)". Fauna Europaea. Retrieved February 19, 2018. It has also been recorded from central Asia, including Iran and KyrgyzstanBOLD Systems and North America where it has been recorded in southern Ontario and northern Indiana."80 1471 (4992.5) Paracorsia repandalis" . Ontario Moths. Retrieved February 19, 2018. The wingspan is 24–28 mm.Microlepidoptera.nl Adults are on wing from April to October in two generations per year. The larvae feed on Verbascum species, including Verbascum lychnitis, Verbascum thapsus and Verbascum phlomoides.Lepiforum.de Pupation occurs in early spring after hibernating in a case.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paracorsia repandalis has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections34

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

100Tmostly conserved

115Tmostly conserved

271Amostly conserved

386Cmostly conserved

628Gmostly conserved

631Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAGTTGGAACATCTCTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes8

BIN1

Most divergent pair0.91%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pagyda salvalissame family6.1%Palpita venatalissame family7.3%Anania flavasame family7.6%Glyphodes shafferorumsame family7.8%Glycythyma thymedessame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 887 records

Wild obs. + sensor1 748

Museum / vouchered111

Other28

Origin

Native1

Range

Area of Occupancy AOO3 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 815≤1 km 436≤10 km 107>10 km 69

1 427 georeferenced · 321 without coordinates

Open the mapobservation + sensor1 748

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 5≤1 km 35≤10 km 49>10 km 2

91 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	34
Provincia di Livornolocation not on record	23
East Lansing, US	7
ZAF-UMUlocation not on record	6
Philadelphia, US	2
Tartu, EE	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Bavarian State Collection of Zoologylocation not on record	1

8 institutions · 75 of 111 vouchered records shown · 36 without an institution code

09Environmental DNA34 detections

Where the DNA of Paracorsia repandalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map9 countries0

garden/forest edge/olive field/meadowother

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.3 °C 9.60–21.7

Seasonal swing summer↔winter19.8 °C

Max temp (day)20.2 °C 14.0–25.2

Min temp (night)12.8 °C 4.20–18.4

Precipitation70.7 mm/mo 15.0–112

Air humidity58.3 % 52.2–61.3

Moisture balance-60.4 mm/mo -123–6.10

Vapour deficit837 Pa 485–1,129

Wind speed2.50 m/s 1.40–5.50

Cloud cover36.3 % 25.4–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Paracorsia repandalis

At a glance

Sources7 archives

At a glance

Record type1 887 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 887 records