Paraclinus nigripinnis

(Steindachner, 1867) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Labrisomidae/Paraclinus

At a glance

Occurrence records970

Data sources9

Biological traits7

DNA specimens14

eDNA detections7

Sources9 archives

Databases and archives Paraclinus nigripinnis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility451 records↗

OBISOcean Biodiversity Information System519 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS970 records

Environmental DNA1 datasets · 5 countries7 detections

DNA & barcodingBOLD14 specimens

01Narrative

Paraclinus nigripinnis, the Blackfin blenny, is a species of labrisomid blenny native to the western Atlantic Ocean and the Caribbean Sea from southern Florida to Brazil. It inhabits coral reefs, areas of eroded limestone, tide pools, and rocky areas with algal growth down to depths of around 10 m. This species can reach a length of 6.5 cm TL. It can also be found in the aquarium trade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max10 m

Depth min0 m

Vulnerability10

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paraclinus nigripinnis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections7

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

4Cmostly conserved

17Gmostly conserved

19Tmostly conserved

22Cmostly conserved

31Cvariable

67Cmostly conserved

73Cmostly conserved

121Cmostly conserved

196Tmostly conserved

211Cmostly conserved

232Cmostly conserved

247Tmostly conserved

265Tmostly conserved

280Cmostly conserved

283Cmostly conserved

292Cmostly conserved

301Gmostly conserved

319Gmostly conserved

325Tmostly conserved

334Cmostly conserved

343Gmostly conserved

385Amostly conserved

412Amostly conserved

415Tmostly conserved

454Cmostly conserved

457Tmostly conserved

481Gmostly conserved

487Tmostly conserved

490Amostly conserved

496Gmostly conserved

514Cmostly conserved

529Tmostly conserved

532Amostly conserved

541Cmostly conserved

550Cmostly conserved

565Amostly conserved

595Tmostly conserved

601Amostly conserved

604Cmostly conserved

622Avariable

625Amostly conserved

640Tmostly conserved

649Tmostly conserved

652Amostly conserved

CCTCTATTTAATCTTTGGTGCCTGAGCCGGCATAGTCGGGACTGCTTTAAGTCTCCTTATCCGGGCCGAACTCAGCCAACCCGGGGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BINs2

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paraclinus fasciatussame genus14.1%Gobioclinus haitiensissame family15.5%Iniistius melanopussame order15.7%Acanthaluteres browniisame order15.8%Thamnaconus arenaceussame order16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type970 records

Wild obs. + sensor142

Museum / vouchered827

Other1

Origin

Native42

Range

Area of Occupancy AOO1 420 km²

Depth

0–200 m sunlit87

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 30 m · 87 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 67≤10 km 3>10 km 6

76 georeferenced · 66 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 56≤10 km 54>10 km 3

113 georeferenced · 714 without coordinates

Open the institutions mapphysical evidence827

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	157
Washington, US	51
Chicago, US	49
Toronto, CA	34
Los Angeles, US	26
Texas Cooperative Wildlife Collectionlocation not on record	15
FishBaselocation not on record	9
Ann Arbor, US	9
Research Collection of Benjamin Victorlocation not on record	7
Morelia, MX	6
University of California San Diegolocation not on record	5
USP-RPlocation not on record	5
Cambridge, US	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
CASlocation not on record	3
New Haven, US	2
Tapachula, MX	2
UFMSlocation not on record	1
Museu de Zoologia da Universidade de Sao Paulolocation not on record	1
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	1
MZLUlocation not on record	1
UNICAMPlocation not on record	1
University of Alabamalocation not on record	1

23 institutions · 393 of 827 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Paraclinus nigripinnis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.0–27.0

Seasonal swing summer↔winter2.80 °C

Max temp (day)26.6 °C 25.8–28.4

Min temp (night)25.0 °C 24.3–25.6

Precipitation118 mm/mo 79.5–218

Air humidity62.3 % 61.0–65.2

Moisture balance-97.6 mm/mo -131–62.1

Vapour deficit1,250 Pa 1,173–1,299

Wind speed5.00 m/s 3.60–5.40

Cloud cover26.3 % 22.3–37.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)