Paraclemensia acerifoliella

(Fitch, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Incurvariidae/Paraclemensia

At a glance

Occurrence records790

Data sources7

Biological traits0

DNA specimens29

eDNA detections28

Sources7 archives

Databases and archives Paraclemensia acerifoliella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility790 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF790 records

Environmental DNA1 datasets · 2 countries28 detections

DNA & barcodingBOLD29 specimens

01Narrative

Paraclemensia acerifoliella, the maple leafcutter moth, is a moth of the family Incurvariidae. It is found from south-eastern Canada and the north-eastern United States, south to the tip of the Appalachian Mountains in western North Carolina and possibly north-western Georgia.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paraclemensia acerifoliella has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 66 variable positions, in barcode order

142Cvariable

262Amostly conserved

271Cmostly conserved

346Cmostly conserved

355Tmostly conserved

428Tmostly conserved

496Amostly conserved

509Tmostly conserved

510Gmostly conserved

512Gmostly conserved

513Cmostly conserved

514Tmostly conserved

516Tmostly conserved

519Cmostly conserved

521Amostly conserved

522Tmostly conserved

525Cmostly conserved

526Amostly conserved

527Gmostly conserved

530Tmostly conserved

531Tmostly conserved

546Cmostly conserved

547Tmostly conserved

549Tmostly conserved

550Amostly conserved

551Cmostly conserved

552Cmostly conserved

554Gmostly conserved

555Tmostly conserved

556Avariable

557Tmostly conserved

560Gmostly conserved

561Cmostly conserved

564Gmostly conserved

567Cmostly conserved

568Tmostly conserved

569Amostly conserved

570Tmostly conserved

573Cmostly conserved

576Tmostly conserved

577Amostly conserved

578Cmostly conserved

580Tmostly conserved

581Tmostly conserved

583Amostly conserved

584Amostly conserved

585Cmostly conserved

586Tmostly conserved

587Gmostly conserved

588Amostly conserved

590Cmostly conserved

591Gmostly conserved

592Amostly conserved

593Amostly conserved

594Amostly conserved

595Tmostly conserved

596Cmostly conserved

597Tmostly conserved

599Amostly conserved

600Amostly conserved

603Cmostly conserved

604Amostly conserved

605Tmostly conserved

616Tvariable

625Amostly conserved

628Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAATATCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes9

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Incurvaria ploesslisame family10.5%Incurvaria vetulellasame family10.6%Heterostegane rectistrigasame order12.0%Ethmia hammellasame order12.5%Macrobrochis fukiensissame order12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type790 records

Wild obs. + sensor725

Museum / vouchered65

Range

Area of Occupancy AOO1 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 314≤1 km 59≤10 km 26>10 km 26

425 georeferenced · 300 without coordinates

Open the mapobservation + sensor725

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 11>10 km 5

16 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	11
University of Alberta Museums (UAM)location not on record	10
Washington, US	8
SOVTlocation not on record	7
East Lansing, US	4
Mississippi State, US	2
Cambridge, US	2
New Haven, US	2
Cornell University Insect Collectionlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

10 institutions · 49 of 65 vouchered records shown · 16 without an institution code

09Environmental DNA28 detections

Where the DNA of Paraclemensia acerifoliella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 8.70–16.0

Seasonal swing summer↔winter28.3 °C

Max temp (day)18.0 °C 11.7–21.0

Min temp (night)8.90 °C 4.80–13.2

Precipitation94.8 mm/mo 62.3–127

Air humidity61.2 % 56.6–64.6

Moisture balance-0.8 mm/mo -46.4–41.6

Vapour deficit566 Pa 425–776

Wind speed3.10 m/s 2.50–3.70

Cloud cover43.8 % 39.2–56.3

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)