Paracinema tricolor

(Thunberg, 1815) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Paracinema

At a glance

Occurrence records1 935

Data sources7

Biological traits0

DNA specimens9

eDNA detections6

Sources7 archives

Databases and archives Paracinema tricolor's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 935 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 935 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD9 specimens

01Narrative

Paracinema tricolor is a species of band-winged grasshopper in the family Acrididae. It is found in Africa, Europe, and the Middle East.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paracinema tricolor has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 27 variable positions, in barcode order

79Gmostly conserved

94Amostly conserved

124Cmostly conserved

151Tmostly conserved

157Tmostly conserved

172Cvariable

178Cvariable

193Cmostly conserved

211Gmostly conserved

214Cmostly conserved

244Amostly conserved

250Cmostly conserved

271Cmostly conserved

287Tmostly conserved

301Tmostly conserved

313Amostly conserved

340Tmostly conserved

347Tmostly conserved

364Cmostly conserved

367Cmostly conserved

370Amostly conserved

421Amostly conserved

445Cmostly conserved

495Cmostly conserved

508Amostly conserved

539Tmostly conserved

550Amostly conserved

TACTTTATATTTTATATTCGGGGCCTGATCGGGAATAGTAGGTACATCAATAAGAATAATTATTCGTGCTGAGCTAGGGCAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphingonotus fuscoirroratussame family12.7%Psoloessa delicatulasame family12.9%Chortophaga australiorsame family12.9%Leva indicasame family13.1%Aulocara elliottisame family13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 935 records

Wild obs. + sensor1 487

Museum / vouchered446

Other2

Range

Area of Occupancy AOO3 712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 469≤1 km 160≤10 km 453>10 km 38

1 120 georeferenced · 367 without coordinates

Open the mapobservation + sensor1 487

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤1 km 58≤10 km 25

83 georeferenced · 363 without coordinates

Open the institutions mapphysical evidence446

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	292
Muséum d'histoire naturelle de Marseillelocation not on record	55
CASlocation not on record	30
National Museums of Kenyalocation not on record	24
Durban Natural Science Museumlocation not on record	9
Museu Nacional de História Natural e da Ciêncialocation not on record	3
Colorado State Universitylocation not on record	2
Stockholm, SE	1

8 institutions · 416 of 446 vouchered records shown · 29 without an institution code

09Environmental DNA6 detections

Where the DNA of Paracinema tricolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.3 °C 17.6–25.7

Seasonal swing summer↔winter17.7 °C

Max temp (day)28.2 °C 23.4–31.0

Min temp (night)16.2 °C 11.1–19.5

Precipitation18.7 mm/mo 12.6–26.4

Air humidity52.4 % 48.0–52.9

Moisture balance-160 mm/mo -183–-94.9

Vapour deficit1,294 Pa 1,031–1,725

Wind speed3.20 m/s 2.50–4.00

Cloud cover35.5 % 32.5–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Paracinema tricolor

At a glance

Sources7 archives

At a glance

Record type1 935 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 935 records