Parachronistis albiceps

(Zeller, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Parachronistis

At a glance

Occurrence records1 503

Data sources9

Biological traits2

DNA specimens42

eDNA detections51

Sources9 archives

Databases and archives Parachronistis albiceps's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 503 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 503 records

Environmental DNA3 datasets · 10 countries51 detections

DNA & barcodingBOLD42 specimens

Genome at a glanceGoaT · NCBI≈400 Mbp

01Narrative

Parachronistis albiceps, the wood groundling, is a moth of the family Gelechiidae. It is found in most of Europe, except the Iberian Peninsula and part of the Balkan Peninsula.Fauna Europaea Outside of Europe, it is found in southern Siberia (Transbaikalia, Altai), the Russian Far East and Korea.et al. 2010: The gelechiid fauna of the southern Ural Mountains, part II: list of recorded species with taxonomic notes (Lepidoptera: Gelechiidae). Zootaxa, 2367: 1–68. Preview The wingspan is 10–12 mm.microlepidoptera.nl Adults are on wing in June and July.UKmoths The larvae feed on Corylus (including Corylus avellana), Ulmus and Prunus persica species. They feed inside the buds of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parachronistis albiceps has left across the world's sequence archives.

At a glance

DNA specimens42

BINs5

Marker genes1

eDNA detections51

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

5Tmostly conserved

10Tmostly conserved

68Gmostly conserved

100Gvariable

106Tmostly conserved

118Cvariable

133Cmostly conserved

166Gmostly conserved

169Cvariable

190Gvariable

205Cmostly conserved

214Avariable

247Tmostly conserved

268Amostly conserved

274Tvariable

334Tmostly conserved

343Tmostly conserved

385Cmostly conserved

386Tmostly conserved

409Amostly conserved

415Amostly conserved

433Tvariable

448Cmostly conserved

451Tmostly conserved

466Amostly conserved

476Amostly conserved

478Amostly conserved

506Gmostly conserved

514Tmostly conserved

530Tmostly conserved

574Tmostly conserved

580Gvariable

616Cmostly conserved

625Amostly conserved

628Gmostly conserved

634Cmostly conserved

643Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTCTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes12

BINs4

Most divergent pair4.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Filatima vacciniisame family10.1%Denisia fuscicapitellasame order10.2%Ianius moscasame order10.3%Pterotaea sperryaesame order10.3%Anthela callispilasame order10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Parachronistis albiceps carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈400 253 216 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Parachronistis albiceps0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness94.5% BUSCO

08Occurrence & distribution

Record type1 503 records

Wild obs. + sensor1 185

Museum / vouchered296

Other22

Origin

Native2

Range

Area of Occupancy AOO2 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 294≤1 km 172≤10 km 632>10 km 3

1 101 georeferenced · 84 without coordinates

Open the mapobservation + sensor1 185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 123≤1 km 54≤10 km 5

182 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence296

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	85
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	48
NHMOlocation not on record	34
Tartu, EE	19
SLU Artdatabankenlocation not on record	17
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	15
Provincia di Livornolocation not on record	13
Stockholm, SE	7
Nijmegen, NL	4
ZSMlocation not on record	4
Tilburg, NL	4
South Kensington, GB	4
European Distributed Institute of Taxonomy (EDIT)location not on record	3
neflocation not on record	3
Salzburg, AT	2
Natural History Museum Rotterdamlocation not on record	2
Rovaniemi, FI	1
University of Oslo, Natural History Museumlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Brussels, BE	1
Natural History Museum, Londonlocation not on record	1

22 institutions · 270 of 296 vouchered records shown · 26 without an institution code

09Environmental DNA51 detections

Where the DNA of Parachronistis albiceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys3

Countries10

Verifiable raw sequence linked13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map10 countries0

ochard next to Euxine-Colchic deciduous fore…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 13.4–17.7

Seasonal swing summer↔winter19.2 °C

Max temp (day)18.6 °C 17.0–21.7

Min temp (night)10.9 °C 8.20–14.5

Precipitation83.0 mm/mo 52.1–183

Air humidity59.7 % 57.0–62.8

Moisture balance-38.9 mm/mo -72.3–62.3

Vapour deficit685 Pa 613–923

Wind speed2.70 m/s 2.10–3.80

Cloud cover40.1 % 33.8–46.6

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Parachronistis albiceps

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 503 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 503 records