Parachaeturichthys polynema

(Bleeker, 1853) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Parachaeturichthys

At a glance

Occurrence records398

Data sources9

Biological traits5

DNA specimens44

eDNA detections51

Sources9 archives

Databases and archives Parachaeturichthys polynema's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility181 records↗

OBISOcean Biodiversity Information System217 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS398 records

Environmental DNA1 datasets · 3 countries51 detections

DNA & barcodingBOLD44 specimens

01Narrative

Parachaeturichthys polynema is een straalvinnige vissensoort uit de familie van grondels (Gobiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door Bleeker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length15 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parachaeturichthys polynema has left across the world's sequence archives.

At a glance

DNA specimens44

BINs3

Marker genes1

eDNA detections51

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P637 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

19Avariable

70Tvariable

196Cvariable

199Gvariable

229Tvariable

271Tvariable

274Avariable

328Cmostly conserved

331Amostly conserved

334Cmostly conserved

349Tmostly conserved

358Amostly conserved

361Cmostly conserved

370Cmostly conserved

376Tmostly conserved

397Avariable

430Cvariable

451Gmostly conserved

481Amostly conserved

484Gvariable

487Tmostly conserved

499Amostly conserved

535Cvariable

592Cmostly conserved

598Tmostly conserved

613Gmostly conserved

628Tvariable

631Gmostly conserved

634Cvariable

637Avariable

TGGTGCTTGAGCCGGAATAGTAGGAACAGCATTAAGCCTGCTTATTCGGGCAGAATTAAGCCAACCTGGTGCTCTCCTAGGAGACGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes13

BINs3

Most divergent pair7.7%

AsiaOtherOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drombus triangularissame family16.0%Cryptocentrus leptocephalussame family16.2%Cryptocentrus melanopussame family16.3%Istigobius goldmannisame family16.8%Callogobius maculipinnissame family17.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_066402 ↗ · 13 protein · 24 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type398 records

Wild obs. + sensor98

Museum / vouchered290

Other10

Origin

Native3

Range

Area of Occupancy AOO728 km²

Depth

0–200 m sunlit68

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 25.8 m · max 65 m · 68 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 2≤1 km 52>10 km 6

60 georeferenced · 38 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 9≤1 km 47≤10 km 17>10 km 15

88 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence290

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	24
Kagoshima University Museumlocation not on record	20
Natick, US	14
Australian National Fish Collectionlocation not on record	10
Museum and Art Gallery of the Northern Territorylocation not on record	7
CASlocation not on record	6
Paris, FR	4
Curtin Universitylocation not on record	4
South African Institute for Aquatic Biodiversitylocation not on record	4
Sydney, AU	4
Louisiana State University, Museum of Zoologylocation not on record	3
Western Australian Museumlocation not on record	3
SEAOBISlocation not on record	2
FishBaselocation not on record	2
Cambridge, US	1
Museums Victorialocation not on record	1
Toronto, CA	1
Yokosuka City Museumlocation not on record	1
DEWlocation not on record	1
Frankfurt am Main	1
Chicago, US	1
Ann Arbor, US	1

22 institutions · 115 of 290 vouchered records shown · 39 without an institution code

09Environmental DNA51 detections

Where the DNA of Parachaeturichthys polynema was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 17.4–26.5

Seasonal swing summer↔winter12.5 °C

Max temp (day)25.0 °C 18.2–28.0

Min temp (night)23.1 °C 16.3–24.9

Precipitation116 mm/mo 34.8–233

Air humidity64.5 % 60.4–66.9

Vapour deficit1,076 Pa 727–1,225

Cloud cover55.7 % 38.2–63.8

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)