Paracercion calamorum

(Ris, 1916) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Paracercion

At a glance

Occurrence records2 608

Data sources7

Biological traits0

DNA specimens55

eDNA detections57

Sources7 archives

Databases and archives Paracercion calamorum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 608 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 608 records

Environmental DNA1 datasets · 2 countries57 detections

DNA & barcodingBOLD55 specimens

01Narrative

Paracercion calamorum, the dusky lilly-squatter, is a species of damselfly in the family Coenagrionidae. It has a range that extends from southern far-eastern Russia to Japan, and to India and Indonesia. The nominate subspecies P. c. calamorum is known from central and eastern China, Korea and Japan. The subspecies P. c. dyeri occurs in southern China, Hong Kong, Taiwan, Indonesia, India, Nepal, and Thailand.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paracercion calamorum has left across the world's sequence archives.

At a glance

DNA specimens55

BINs1

Marker genes3

eDNA detections57

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P539 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

191Amostly conserved

212Gmostly conserved

221Cmostly conserved

224Tmostly conserved

302Tmostly conserved

317Gmostly conserved

371Cmostly conserved

380Tmostly conserved

413Cmostly conserved

423Tmostly conserved

464Gmostly conserved

470Cmostly conserved

503Amostly conserved

509Amostly conserved

TAGTAGTAACTGCACACGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAACTGACTAGTTCCATTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes6

BIN1

Most divergent pair1.3%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paracercion v-nigrumsame genus6.7%Paracercion melanotumsame genus8.5%Paracercion sieboldiisame genus8.6%Paracercion hieroglyphicumsame genus8.7%Paracercion plagiosumsame genus11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type2 608 records

Wild obs. + sensor2 326

Museum / vouchered282

Range

Area of Occupancy AOO6 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 365≤1 km 141≤10 km 45>10 km 69

620 georeferenced · 1 706 without coordinates

Open the mapobservation + sensor2 326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 278 without coordinates

Open the institutions mapphysical evidence282

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toyama, JP	213
Kawasaki Shi Tama Ku, JP	20
NSMKlocation not on record	16
National Institute of Biological Resourceslocation not on record	11
DRIBlocation not on record	5
Iwate Prefectural Museumlocation not on record	4
Cornell University Insect Collectionlocation not on record	4
DNSMlocation not on record	3
Chiba, JP	1
RCMlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
University Park, US	1
Itami Shi, JP	1

13 institutions · 281 of 282 vouchered records shown · 1 without an institution code

09Environmental DNA57 detections

Where the DNA of Paracercion calamorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 5.50–20.1

Seasonal swing summer↔winter30.2 °C

Max temp (day)16.6 °C 11.1–22.2

Min temp (night)6.40 °C 0–14.6

Precipitation22.1 mm/mo 11.0–214

Air humidity49.4 % 46.1–58.7

Moisture balance-30.9 mm/mo -90.5–80.7

Vapour deficit630 Pa 458–992

Wind speed2.80 m/s 2.00–3.20

Cloud cover22.8 % 20.3–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Paracercion calamorum

At a glance

Sources7 archives

At a glance

Record type2 608 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 608 records