Paracerceis sculpta

(Holmes, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Isopoda/Sphaeromatidae/Paracerceis

At a glance

Occurrence records470

Data sources9

Biological traits3

DNA specimens30

eDNA detections28

Sources9 archives

Databases and archives Paracerceis sculpta's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility317 records↗

OBISOcean Biodiversity Information System153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS470 records

Environmental DNA1 datasets · 4 countries28 detections

DNA & barcodingBOLD30 specimens

01Narrative

Paracerceis sculpta is a species of marine isopod between 1.3 mm and 10.3 mm in length. The species lives mainly in the intertidal zone, and is native to the Northeast Pacific from Southern California to Mexico, but has since been introduced to many other countries. Adults are herbivorous and consume algae but juveniles are carnivorous and consume moulting females. They reproduce in sponges but do not feed near them.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Depth min0 m

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paracerceis sculpta has left across the world's sequence archives.

At a glance

DNA specimens30

BINs3

Marker genes2

eDNA detections28

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 126 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

13Cvariable

16Tmostly conserved

20Gmostly conserved

22Avariable

34Gmostly conserved

39Tmostly conserved

43Amostly conserved

46Amostly conserved

49Tmostly conserved

50Tmostly conserved

52Amostly conserved

55Gmostly conserved

67Amostly conserved

70Tmostly conserved

73Gmostly conserved

74Tmostly conserved

79Gmostly conserved

82Cmostly conserved

106Cmostly conserved

109Gmostly conserved

115Cmostly conserved

121Gmostly conserved

124Amostly conserved

130Amostly conserved

145Gmostly conserved

163Tmostly conserved

175Gmostly conserved

181Gmostly conserved

184Amostly conserved

196Gmostly conserved

197Cmostly conserved

199Tmostly conserved

202Cmostly conserved

208Amostly conserved

220Gmostly conserved

223Gmostly conserved

229Gmostly conserved

232Tmostly conserved

235Cmostly conserved

259Cmostly conserved

263Tmostly conserved

265Gmostly conserved

271Avariable

278Cmostly conserved

280Tmostly conserved

284Cmostly conserved

286Tmostly conserved

287Tmostly conserved

289Amostly conserved

290Cvariable

292Amostly conserved

316Amostly conserved

325Gmostly conserved

328Gmostly conserved

331Gmostly conserved

337Tmostly conserved

340Cmostly conserved

346Amostly conserved

352Amostly conserved

358Amostly conserved

364Tmostly conserved

367Cmostly conserved

391Gmostly conserved

394Cmostly conserved

400Cmostly conserved

412Tmostly conserved

415Gmostly conserved

421Tmostly conserved

433Amostly conserved

448Cmostly conserved

454Tmostly conserved

466Amostly conserved

469Amostly conserved

475Cvariable

481Amostly conserved

493Amostly conserved

496Tmostly conserved

499Cmostly conserved

500Tmostly conserved

508Tmostly conserved

514Tmostly conserved

523Cmostly conserved

529Amostly conserved

541Gmostly conserved

542Tmostly conserved

544Amostly conserved

553Amostly conserved

562Cvariable

568Amostly conserved

574Tmostly conserved

586Gmostly conserved

595Cmostly conserved

598Amostly conserved

616Cmostly conserved

619Cmostly conserved

622Amostly conserved

628Amostly conserved

631Gmostly conserved

633Amostly conserved

634Cvariable

637Tmostly conserved

638Gmostly conserved

639Tmostly conserved

640Tmostly conserved

641Tmostly conserved

643Gmostly conserved

645Amostly conserved

646Cmostly conserved

647Cmostly conserved

648Amostly conserved

649Amostly conserved

650Cmostly conserved

+6 more variable positions not shown

AACTTTATATTTCATTTTTGGAGCTTGAGCAGGGGCAGTAGGAACAGCTTTAAGGATAATTATTCGAACTGAGTTAGGGCACCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.2%

Haplotypes10

BINs3

Most divergent pair20.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paracerceis cordatasame genus15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type470 records

Wild obs. + sensor108

Museum / vouchered317

Other45

Origin

Introduced50

Range

Area of Occupancy AOO888 km²

Depth

0–200 m sunlit59

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 54 m · 59 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 11≤1 km 8≤10 km 3

22 georeferenced · 86 without coordinates

Open the mapobservation + sensor108

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 125≤1 km 12≤10 km 13>10 km 3

153 georeferenced · 164 without coordinates

Open the institutions mapphysical evidence317

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Australian Museumlocation not on record	41
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	39
Washington, US	29
Sydney, AU	23
Honolulu, US	21
Los Angeles, US	11
CASlocation not on record	10
San Nicolás de los Garza, MX	9
Natural History Museum of Los Angeles County, Marine Biodiversity Centerlocation not on record	8
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Mexico City, MX	4
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	4
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
IBIOMARlocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Natick, US	1
Museums Victorialocation not on record	1
Instituto de Investigaciones Oceanológicas, Universidad Autónoma de Baja Californialocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1

21 institutions · 217 of 317 vouchered records shown · 6 without an institution code

09Environmental DNA28 detections

Where the DNA of Paracerceis sculpta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map4 countries0

marina floating boat dockboat docks; from kayak by hand w. paint scra…algae and seagrasseel grass

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 13.4–21.8

Seasonal swing summer↔winter7.60 °C

Max temp (day)21.4 °C 16.8–28.0

Min temp (night)16.5 °C 10.5–17.8

Precipitation4.40 mm/mo 0.7–67.1

Air humidity60.4 % 55.7–69.7

Moisture balance-11.9 mm/mo

Vapour deficit678 Pa 617–1,060

Wind speed3.80 m/s

Cloud cover15.3 % 10.2–38.3

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)