Paracentropogon longispinis

(Cuvier, 1829) · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Tetrarogidae/Paracentropogon

At a glance

Occurrence records870

Data sources9

Biological traits6

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Paracentropogon longispinis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility437 records↗

OBISOcean Biodiversity Information System433 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS870 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Paracentropogon longispinis, the wispy waspfish, sailfin waspfish, whiteface waspfish or whiteface roguefish, is a species of marine ray-finned fish, a waspfish belonging to the subfamily Tetraroginae, which is classified as part of the family Scorpaenidae, the scorpionfishes and their relatives. It is found in the central Indo-West Pacific. It is the type species of the genus Paracentropogon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length13 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits2

Depth max70 m

Vulnerability10

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paracentropogon longispinis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes2

BIN1

Most divergent pair0.77%

Where individuals differ — all 5 variable positions, in barcode order

4Cmostly conserved

373Amostly conserved

469Tmostly conserved

643Tmostly conserved

649Cmostly conserved

CCTCTATTTAGTATTTGGTGCTTGAGCCGGTATAGTAGGCACAGCTTTAAGCCTTCTGATCCGAGCAGAACTAAGCCAACCTGGGGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gnathanacanthus goetzeeisame order12.7%Ocosia zaspilotasame family13.7%Synanceia horridasame family13.7%Snyderina guentherisame family14.0%Ablabys taenianotussame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type870 records

Wild obs. + sensor288

Museum / vouchered398

Cultivated / captive182

Other2

Origin

Native6

Range

Area of Occupancy AOO972 km²

Depth

0–200 m sunlit119

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 19.8 m · max 138 m · 119 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 28≤1 km 126≤10 km 10>10 km 19

183 georeferenced · 105 without coordinates

Open the mapobservation + sensor288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 44≤1 km 88≤10 km 51>10 km 34

217 georeferenced · 181 without coordinates

Open the institutions mapphysical evidence398

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 182

182 georeferenced

Open the mapnot free-living182

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	60
CASlocation not on record	28
Museum and Art Gallery of the Northern Territorylocation not on record	24
Washington, US	9
DEWlocation not on record	9
Paris, FR	8
Cambridge, US	6
Los Angeles, US	4
	3
Sydney, AU	3
Frankfurt am Main	3
Natick, US	2
Kagoshima University Museumlocation not on record	2
Louisiana State University, Museum of Zoologylocation not on record	2
FishBaselocation not on record	1
SEAOBISlocation not on record	1
Western Australian Museumlocation not on record	1

17 institutions · 166 of 398 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Paracentropogon longispinis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 26.9–27.4

Seasonal swing summer↔winter2.70 °C

Max temp (day)28.2 °C 28.2–28.6

Min temp (night)26.2 °C 25.2–26.2

Precipitation345 mm/mo 182–376

Air humidity65.1 % 63.4–65.6

Vapour deficit1,262 Pa 1,242–1,293

Cloud cover74.6 % 60.2–79.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)