Papilio polymnestor

Cramer, 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Papilionidae/Papilio

At a glance

Occurrence records640

Data sources6

Biological traits0

DNA specimens9

eDNA detections0

Sources6 archives

Databases and archives Papilio polymnestor's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility640 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF640 records

DNA & barcodingBOLD9 specimens

01Narrative

Papilio polymnestor, the blue Mormon, is a large swallowtail butterfly found in south India and Sri Lanka. It is the "state butterfly" of the Indian state of Maharashtra. With a wingspan of 120–150 mm, it is the fourth largest butterfly of India.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Papilio polymnestor has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P630 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.07%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

200Tmostly conserved

TATTAGGAACCTCATTAAGCTTATTAATTCGAACAGAACTAGGAATTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Papilio rumanzoviasame genus3.9%Papilio macilentussame genus5.3%Papilio bootessame genus6.7%Papilio arcturussame genus6.9%Papilio protenorsame genus6.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type640 records

Wild obs. + sensor570

Museum / vouchered70

Origin

Native3

Range

Area of Occupancy AOO764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 6≤1 km 61≤10 km 2

69 georeferenced · 501 without coordinates

Open the mapobservation + sensor570

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 1≤1 km 1≤10 km 8>10 km 29

39 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	21
Sanda, JP	14
Cleveland Museum of Natural History, OH (CLEV)location not on record	9
Auckland, NZ	7
Zürich, CH	6
Natural History Museum of Utahlocation not on record	2
Provincia di Pesaro e Urbinolocation not on record	1
New Haven, US	1
Denver, US	1
Brussels, BE	1

10 institutions · 63 of 70 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)