Papaver rhoeas
speciesAt a glance
Occurrence records401 416
Data sources13
Biological traits75
DNA specimens60
eDNA detections33
Sources13 archives
Databases and archives Papaver rhoeas's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility401 416 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics60 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources75 traits
Chemical compositionLOTUS73 compounds
Occurrence & distributionGBIF401 416 records
Environmental DNA1 datasets · 11 countries33 detections
DNA & barcodingBOLD · NCBI60 specimens
Genome at a glanceCCDB · GoaT2.5 Gbp
01Narrative
Le coquelicot est une espèce de plantes à fleurs dicotylédones de la famille des Papaveraceae. C'est une plante herbacée originaire du bassin méditerranéen. C'est une annuelle, très abondante dans les terrains fraîchement remués à partir du printemps, qui se distingue par la couleur rouge de ses fleurs et par le fait qu'elle forme souvent de grands tapis colorés visibles de très loin. Elle appartient au groupe des plantes dites messicoles car elle est associée à l'agriculture depuis des temps très anciens, grâce à son cycle biologique adapté aux cultures de céréales, la floraison et la mise à graines intervenant avant la moisson. Très commune dans différents pays d'Europe, elle a beaucoup régressé du fait de l'emploi généralisé des herbicides et de l'amélioration du tri des semences de céréales. En Guyane, le nom coquelicot désigne l'espèce Rhynchanthera grandiflora en raison de la proximité dans l'usage médicinal.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology28
Fruit length20 mm
⚠ sources differ — AusTraits: 20 mm · GIFT: 14.5 mm
Fruit length max22 mm
Fruit length min8 mm
Fruit width11 mm
Fruit width max13 mm
Fruit width min7 mm
Leaf length150 mm
⚠ sources differ — AusTraits: 150 mm · GIFT: 90 mm
Leaf length max200 mm
Leaf length min30 mm
Leaf mass167 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 4 986 mm² · GIFT: 4 986 mm²
Leaf width45 mm
Leaf width max60 mm
Leaf width min10 mm
Petiole length2 cm
Plant height0.404 m
⚠ sources differ — GIFT: 0.404 m · AusTraits: 0.8 m · LEDA: 0.4 m · TRY: 0.424 m
Plant height generative0.552 m
Plant height max1 m
Plant height min0.1 m
Seed length0.802 mm
⚠ sources differ — TRY: 0.802 mm · GIFT: 0.9 mm
Seed length max0.9 mm
Seed length min0.9 mm
Seed mass0.114 mg
⚠ sources differ — TRY: 0.114 mg · LEDA: 0.11 mg · GIFT: 0.159 mg
Seed mass max0.4 mg
Seed mass min0.04 mg
Seed volume0.17 mm³
Seed volume max0.17 mm³
Seed volume min0.17 mm³
Life cycle & reproduction19
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: anemochorous
Flower colourred
Flower length max60 mm
Flower length min20 mm
Flower width max60 mm
Flower width min30 mm
Flowering endJul
Flowering startMay
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number20 000
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 900 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio10.23 g/g
Leaf c382 mg/g
Leaf dry-matter content (LDMC)166 mg/g
⚠ sources differ — TRY: 166 mg/g · LEDA: 143 mg/g
Leaf n37.32 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)25.72 mm²/mg
⚠ sources differ — TRY: 25.72 mm²/mg · LEDA: 33 mm²/mg · GIFT: 33.07 mm²/mg
Other traits3
Diaspore typegerminule
Seeds per fruit>1000
Shoot orientationascending
03Chemical composition73 compounds
Compounds documented for Papaver rhoeas across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids12
Isoquinoline alkaloids11
Aporphine alkaloids $ Isoquinoline alkaloids8
Isoquinoline alkaloids $ Protoberberine alkaloids6
Flavonols5
Documented compounds73 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Corytuberine | present | LOTUS | |
| (+)-Cularine | present | LOTUS | |
| (+)-Magnoflorine | present | LOTUS | |
| (+)-Papaverrubine E | present | LOTUS | |
| (+-)-Sinactine | present | LOTUS | |
| (-)-alpha-Narcotine | present | LOTUS | |
| (-)-Mecambridine | present | LOTUS | |
| (13Ar)-3,10-Dimethoxy-6,8,13,13A-Tetrahydro-5H-Isoquinolino(2,1-B)Isoquinoline-2,9-Diol | present | LOTUS | |
| (1R)-11,17-dimethoxy-6,8,12-trioxa-22-azapentacyclo[11.9.0.02,10.05,9.014,19]docosa-2(10),3,5(9),14,16,18-hexaen-16-ol | present | LOTUS | |
| (1R,14R,24S)-13-methyl-5,7,19,21,25-pentaoxa-13-azahexacyclo[12.11.0.02,10.04,8.015,23.018,22]pentacosa-2,4(8),9,15(23),16,18(22)-hexaen-24-ol | present | LOTUS |
05DNA & barcoding60 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Papaver rhoeas has left across the world's sequence archives.
At a glance
DNA specimens60
Marker genes8
GenBank sequences10
eDNA detections33
Countries11
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCCAAGCCTTCGGGCCGAGGGCACGCTTGCCTGGGCGTCACGCACCGAGTCTCCCCC …
Papaver rhoeas subsp. rhoeas voucher PLT.0127 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★trnL-F★ITS6★ITS1★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Papaver rhoeas carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 464 560 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Papaver rhoeas2.46 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–422n range14median14mode101records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1499×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +16
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CASTIGLIA E. - 1955. Sulla poliploidia istologica nei vegetali: osservazioni in Scilla obtusifolia Poiret.. Caryologia , 7(3): 420-437.
CCDB · ita-fl — KIEFT B., LOON J.C. - 1978. IOPB chromosome number reports LXII.. Taxon , 27(5/6): 524-525.
CCDB · ita-fl — LOON J.C., JONG H. - 1978. IOPB chromosome number reports LIX.. Taxon , 27(1): 57-60.
CCDB · ita-fl — RIZZOTTO M. - 1992 (1991). Numeri cromosomici per la flora italiana: 1270-1272.. Inform. Bot. Ital. , 23(2-3): 119-122.
CCDB · ita-fl — D'OVIDIO R. - 1987 (1986). Numeri cromosomici per la flora italiana: 1082-1093.. Inform. Bot. Ital. , 18(1-2-3): 168-175.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Hallonová A., 1982: Floristické pomery horskej skupiny Skalky (Strážovské vrchy). - Stredné Slovensko 2: 308-323.
CCDB · slov-fl — Šályová A., 2007: [New records in Allium, Euphorbia, Luzula, Papaver, Ranunculus, and Tragopogon], pp. 78, 252, 379, 428, 496, 588. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — McNaughton, H. Annual Rep. Scott. Pl. Breed. Sta. 1960: 76-84 (1960)
CCDB · brit-fl — Squirrell, J. Watsonia : (1994)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XVII. Papaveraceae Queirs, M.Bol. Soc. Brot. ser. 254: 153-171(1980).
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 15-17. Garca, I.Lagascalia7(2): 199-201(1977).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1693
CCDB · fl-europaea — Lbvkvist, 1963
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · ipcn-api-dl — Stoeva, M. P. 1985. Chromosome numbers of Bulgarian angiosperms. Fitologija 30: 78–79.
CCDB · ipcn-api-dl — Queiros, M. 1980. Contribuisáo para o conhecimento citotaxonomico das spermatophyta de Portugal XVII Papaveraceae. Bol. Soc. Brot. 54: 153–171.
CCDB · ipcn-api-dl — D'Ovidio, R. 1986. Numeri cromosomici per la flora Italiana: 1082--1093. Inform. Bot. Ital. 18: 168–175.
CCDB · ipcn-api-dl — Kadereit, J. W. 1988. A revision of Papaver L. section Rhoeadium Spach. Notes Roy. Bot. Gard. Edinburgh 45(2): 225–286.
CCDB · ipcn-api-dl — Stoeva, M. P. 1991. Karyological study of the Bulgarian representatives of the genus Papaver L. sect. Orthorhoeades Fedde. Fitologija 40: 40–55.
CCDB · ipcn-api-dl — Baltisberger, M. 1991. IOPB chromosome data 3. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 17: 5–7.
CCDB · ipcn-api-dl — Safonova, I. N. 1991. Chromosome numbers in some species of the family Papaveraceae. Bot. Žhurn. (Moscow & Leningrad) 76: 904–905.
CCDB · ipcn-api-dl — Rizzotto, M. 1991. Numeri cromosomici per la flora Italiana: 1270--1272. Inform. Bot. Ital. 23: 119–122.
CCDB · ipcn-api-dl — Hahn, B. 1994. <In> E. Hörandl, Systematik und Verbreitung von Papaver dubium L. s.l. in österreich. Linzer Biol. Beitr. 26(1): 407–435.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Garcia, I. 1978. In Numeros cromosomicos para la flora Esparhola. 1-44. Lagascalia 7: 191–216.
CCDB · ipcn-api-dl — Kubat, K. 1980. Bemerkungen zu einigen tschechoslowakischen Arten der Gattung Papaver. Preslia 52: 103–115.
CCDB · ipcn-api-dl — López Pacheco, M. J., R. A. Redondo, A. F. Rodríguez, J. I. A. Felpete, C. A. Casado & E. P. Garcia. 2002. Números cromosomáticos de plantas occidentales, 910--920. Anales Jard. Bot. Madrid 59(2): 287.
CCDB · ipcn-api-dl — Runemark, H. 2000. Mediterranean chromosome number reports 10 (1110--1188). Fl. Medit. 10: 386–402.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · ipcn-api-dl — Baytop, A. & M. Saraçoğlu. 1982. Türkiye'nin tek yillik Papaver türleri. Türkiye'nin Papaver türleri üzerinde aras|7tirmalar (Prof. Sarim Çelebioğlu'nun Dr. Phil. ünvanini alis|7inin 50. yildöonümü nedeniyle Istanbul Üniversitesi Eczacilik Fakültesinde yapilan bilimsel toplanti) 28--32.
CCDB · book-ipcn67-71 — KAWATANI, T., & T. OHNO. 1965. Chromosome numbers in Papaver. Bull. Nat. Inst. Hyg. Sci. 83: 127-133.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
+53 more references
2n 151×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Koopmans, A. (1955). A trisomic Papaver rhoeas. Genetica 28: 35-41.
2n 181×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — MARY, T.N., & C.P. MALIK. 1973. Cytogenetic studies in Papaver, III. Induced polyploids in some Papaver species. Chromosome Inf. Serv. 15: 27-29.
2n 211×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Koopmans, A. (1955). A trisomic Papaver rhoeas. Genetica 28: 35-41.
2n 421×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — MARY, T.N., & C.P. MALIK. 1973. Cytogenetic studies in Papaver, III. Induced polyploids in some Papaver species. Chromosome Inf. Serv. 15: 27-29.
n 713×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +4
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 15-17. Garca, I.Lagascalia7(2): 199-201(1977).
CCDB · book-ipcn65 — Ernst 1965
CCDB · ipcn-api-dl — Garcia, I. 1978. In Numeros cromosomicos para la flora Esparhola. 1-44. Lagascalia 7: 191–216.
CCDB · ipcn-api-dl — Koshy, J. K. & P. M. Mathew. 1988. Cytological studies in a few species of the Papaveraceae from south India. Cytologia 53: 647–652.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · book-ipcn72 — KOUL, A.K., R.N. GOHIL, M.C. SHARMA, & H.K. KAPOOR. 1972. Genetic stocks of Kashmir Papavers, I. Plant morphology, chromosome numbers and meiosis. Nucleus 15: 117-123.
CCDB · book-ipcn75-78 — Garcia 1978
CCDB · Cave1963 — Feinbrun 1963a,b
CCDB · CromoCat 2015 — Koshy, J. K. & Mathew, P. (1988). Cytological studies in a few species of the Papaveraceae from south India Cytologia 53: 647-652
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
CCDB · CromoCat 2015 — García, I. (1977). Números cromosómicos para la flora española, 15-17. Lagascalia 7(2): 199-201.
n 82×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971b). Sur la caryologie de quelques plantes récoltées pendant la IIIème Réunion de Botanique Péninsulaire. Mem. Soc. Brot. 21: 343-385.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type401 416 records
Wild obs. + sensor389 601
Museum / vouchered10 925
Cultivated / captive52
Fossil1
Other837
Origin
Native3 980
Introduced6 953
Range
Area of Occupancy AOO441 984 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy31% within 1 km
≤100 m 48 413≤1 km 54 459≤10 km 222 043>10 km 4 005
328 920 georeferenced · 60 681 without coordinates
Open the mapobservation + sensor389 601
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 555≤1 km 2 139≤10 km 3 525>10 km 267
6 486 georeferenced · 4 439 without coordinates
Open the institutions mapphysical evidence10 925
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 19>10 km 17
36 georeferenced · 16 without coordinates
Open the mapnot free-living52
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions170 of 298 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 572 |
| Berlin, DE | 661 |
| LDlocation not on record | 451 |
| Paris, FR | 433 |
| BFLlocation not on record | 412 |
| Olocation not on record | 229 |
| Helsinki, FI | 163 |
| BClocation not on record | 163 |
| MeiseBGlocation not on record | 149 |
| SLU Artdatabankenlocation not on record | 138 |
| València, ES | 130 |
| BDBClocation not on record | 106 |
| Salzburg, AT | 105 |
| Moscow State Universitylocation not on record | 98 |
| Uniwersytet Warszawskilocation not on record | 90 |
| Adam Mickiewicz University in Poznańlocation not on record | 89 |
| Oskarshamn, SE | 79 |
| Trondheim, NO | 77 |
| Entomological Society of Latvialocation not on record | 75 |
| CICYTEXlocation not on record | 66 |
| MAlocation not on record | 65 |
| UniKSlocation not on record | 64 |
| BRNUlocation not on record | 62 |
| KMNlocation not on record | 58 |
| Provincia di Livornolocation not on record | 54 |
| Görlitz, DE | 52 |
| South Kensington, GB | 51 |
| Córdoba, ES | 51 |
| College of the Atlantic, Museumlocation not on record | 50 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 47 |
| Tartu, EE | 45 |
| Barcelona, ES | 38 |
| Museo Entomologico de Leonlocation not on record | 38 |
| Philadelphia, US | 38 |
| DBF-NHMDlocation not on record | 38 |
| Madrid, ES | 38 |
| Bergen, NO | 37 |
| Granada, ES | 33 |
| Oulu, FI | 32 |
| Christchurch, NZ | 32 |
| Adelaide, AU | 32 |
| UGentlocation not on record | 32 |
| Vitoria, ES | 31 |
| Turku, FI | 29 |
| Bern, CH | 28 |
| Salamanca, ES | 27 |
| UIBlocation not on record | 27 |
| Auckland, NZ | 27 |
| Alicante, ES | 25 |
| Phyletisches Museum Jenalocation not on record | 25 |
| Wlocation not on record | 24 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 24 |
| Philadelphia, US | 23 |
| Sevilla, ES | 23 |
| Frankfurt am Main | 22 |
| Hobart, AU | 22 |
| Pamplona, ES | 20 |
| Uppsala, SE | 19 |
| Mlocation not on record | 19 |
| Fort Worth, US | 19 |
| Badajoz, ES | 18 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 18 |
| GJOlocation not on record | 18 |
| Tampere, FI | 17 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 16 |
| Uniwersytet Jagiellońskilocation not on record | 15 |
| Allentown, US | 15 |
| Pullman, US | 15 |
| Uniwersytet Opolskilocation not on record | 15 |
| Natural History Museum Rotterdamlocation not on record | 14 |
| Beijing, CN | 14 |
| Pamplona, ES | 14 |
| BAYLUlocation not on record | 14 |
| Uniwersytet Śląski w Katowicachlocation not on record | 14 |
| Tokushima, JP | 14 |
| TROMlocation not on record | 13 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 13 |
| Chongqing Museumlocation not on record | 13 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 11 |
| New Haven, US | 11 |
| Zürich, CH | 11 |
| Corvallis, US | 10 |
| PrivatHerblocation not on record | 10 |
| Stephenville, US | 10 |
| Saint Louis, US | 10 |
| Durango, MX | 10 |
| Riverside, US | 10 |
| Nanjing, CN | 10 |
| Wellington, NZ | 10 |
| Ann Arbor, US | 9 |
| Frauenfeld, CH | 9 |
| Porrentruy, CH | 9 |
| San Diego, US | 9 |
| PRClocation not on record | 9 |
| Kensington, AU | 8 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 8 |
| Universidad Católica de Santa Maríalocation not on record | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| TUR-Alocation not on record | 8 |
| Zhengzhou, CN | 8 |
| Stockholm, SE | 8 |
| University of Alberta Museumslocation not on record | 8 |
| Henry Brockhouse Collectionlocation not on record | 8 |
| Nagano City, JP | 7 |
| Zürich, CH | 7 |
| Claremont, US | 7 |
| Jyväskylä, FI | 7 |
| Yangling, CN | 7 |
| Wuzhou, CN | 7 |
| NMBU:MINAlocation not on record | 7 |
| Bronx, US | 6 |
| Madison, US | 6 |
| Mount Annan, AU | 6 |
| Kew, GB | 6 |
| Chengdu, CN | 6 |
| Tula State Universitylocation not on record | 6 |
| Logan, US | 6 |
| Moscow, US | 6 |
| Armidale, AU | 6 |
| Victoria, CA | 6 |
| Pretoria, ZA | 6 |
| Jaén, ES | 5 |
| GZUlocation not on record | 5 |
| Kuopio, FI | 5 |
| Dekalb, US | 5 |
| Porvoo, FI | 5 |
| Tallinn, EE | 5 |
| Denver, US | 5 |
| Burlington, US | 5 |
| WTUlocation not on record | 5 |
| Glarus, CH | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Tilburg, NL | 5 |
| Taipei, TW | 5 |
| Canberra, AU | 5 |
| Karlsruhe, DE | 5 |
| Universidad de La Salle (La Salle)location not on record | 5 |
| National Museum Waleslocation not on record | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Bloomington, US | 4 |
| Davis, US | 4 |
| Bando, JP | 4 |
| University of Stellenboschlocation not on record | 4 |
| Flagstaff, US | 4 |
| Chiba, JP | 4 |
| ISAlocation not on record | 4 |
| Fukushima Universitylocation not on record | 4 |
| OLAlocation not on record | 4 |
| BSBIlocation not on record | 4 |
| Ischia Marine Centrelocation not on record | 4 |
| Tsukuba, JP | 4 |
| JBSlocation not on record | 4 |
| Bourges, FR | 4 |
| Arcata, US | 4 |
| CJBGlocation not on record | 4 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| Göteborg, SE | 3 |
| Tampa, US | 3 |
| Podgorica, ME | 3 |
| Boise, US | 3 |
| Fulda, DE | 3 |
| Mexico City, MX | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| Vancouver, CA | 3 |
| Cape Town, ZA | 3 |
| EEZA-CSIClocation not on record | 3 |
| Guangzhou, CN | 3 |
| Xiamen, CN | 3 |
| St. Paul, US | 3 |
| Dresden, DE | 3 |
| Nanchong, CN | 3 |
| Durham, US | 3 |
| Rotorua, NZ | 3 |
| Kunming, CN | 3 |
| Chadron, US | 3 |
| Banyoles, ES | 3 |
| FLADlocation not on record | 3 |
| Xining, CN | 3 |
| DULlocation not on record | 3 |
| ASUlocation not on record | 3 |
| Odawara, JP | 3 |
| Austin, US | 3 |
| Baroda, IN | 3 |
| Tuscaloosa, US | 2 |
| Otaru, JP | 2 |
| Nijmegen, NL | 2 |
| CASlocation not on record | 2 |
| ESP109location not on record | 2 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 2 |
| San Isidro, AR | 2 |
| Northridge, US | 2 |
| Santa Barbara, US | 2 |
| Córdoba, AR | 2 |
| Ivano-Frankove, UA | 2 |
| Qingyang Teachers Collegelocation not on record | 2 |
| Seoul, KR | 2 |
| Riobamba, EC | 2 |
| Wuhan, CN | 2 |
| Shinshu Universitylocation not on record | 2 |
| Guilin, CN | 2 |
| Monastir, TN | 2 |
| Acadia Universitylocation not on record | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| KNAMlocation not on record | 2 |
| Siouxland Heritage Museumlocation not on record | 2 |
| Changsha, CN | 2 |
| Sanda, JP | 2 |
| Urumqi, CN | 2 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 2 |
| Valparaiso, CL | 2 |
| Tromso University Museumlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Blumenau, BR | 2 |
| College Park, US | 2 |
| WNNUlocation not on record | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Winterthur, CH | 1 |
| Aarhus, DK | 1 |
| Brookings, US | 1 |
| JP | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Toyama, JP | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| New Brunswick, US | 1 |
| Provo, US | 1 |
| UNESClocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Namur, BE | 1 |
| Saint John, CA | 1 |
| Alexandria Universitylocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Denton, US | 1 |
| Millersville, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Taipei, TW | 1 |
| Gijón, ES | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| University of Patraslocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| IDElocation not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| San Francisco, US | 1 |
| Columbia, US | 1 |
| SMMUlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Springfield, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| KURAlocation not on record | 1 |
| Université Clermont-Auvergnelocation not on record | 1 |
| Institute of Ecology of the Volga river basin of Russian Academy of Sciences | IEVB RASlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| EL PASO, US | 1 |
| SZUlocation not on record | 1 |
| Université Lavallocation not on record | 1 |
| Valparaíso, CL | 1 |
| Clemson, US | 1 |
| Irvine, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| Minia, EG | 1 |
| Emporia, US | 1 |
| SNSNMClocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| BMlocation not on record | 1 |
| La Paz, BO | 1 |
| UoB-IBlocation not on record | 1 |
| ESP003location not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| SVN019location not on record | 1 |
| Fredericksburg, US | 1 |
| San Bernardino, US | 1 |
| LfUlocation not on record | 1 |
| Brussel, BE | 1 |
| Davenport, US | 1 |
| ESP010location not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| JBCLMlocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Museo de Historia Natural Alfredo Dugés, Universidad de Guanajuatolocation not on record | 1 |
| nbflocation not on record | 1 |
| Caldwell, US | 1 |
| Portland, US | 1 |
| Henderson, US | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Criciúma, BR | 1 |
| Fayetteville, US | 1 |
| BGPAlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| Sion, CH | 1 |
| Chicago, US | 1 |
298 institutions · 9 716 of 10 925 vouchered records shown · 649 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA33 detections
Where the DNA of Papaver rhoeas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found33
Studies independent surveys1
Countries11
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 33 detections have coordinates
Open the map11 countries0
Dichelostemma capitatum, Garrya sp., Heterom…in coastal grassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 9.20–17.3
Seasonal swing summer↔winter15.3 °C
Max temp (day)18.9 °C 11.9–23.2
Min temp (night)10.0 °C 3.80–13.3
Precipitation70.4 mm/mo 13.8–110
Air humidity58.3 % 52.9–65.5
Moisture balance-34.2 mm/mo -95.2–114
Vapour deficit774 Pa 450–893
Wind speed3.90 m/s 2.20–4.90
Cloud cover41.2 % 25.9–54.2
CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.