Papaver lapponicum

(Tolm.) Nordh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Papaver

At a glance

Occurrence records809

Data sources10

Biological traits15

DNA specimens26

eDNA detections24

Sources10 archives

Databases and archives Papaver lapponicum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility809 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF809 records

Environmental DNA1 datasets · 4 countries24 detections

DNA & barcodingBOLD · NCBI26 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Мак лапландский — вид многолетних травянистых растений из рода Мак (Papaver) семейства Маковые (Papaveraceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology3

Plant height0.133 m

Plant height max0.3 m

Plant height min0.1 m

Life cycle & reproduction2

Dispersal typewind

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTarctic

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)13.51 mm²/mg

03Chemical composition3 compounds

Compounds documented for Papaver lapponicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Isoquinoline alkaloids $ Protopine alkaloids2

Isoquinoline alkaloids $ Protoberberine alkaloids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
alpha-Allocryptopine	present	LOTUS
Berberine	present	LOTUS
Protopine	present	LOTUS

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Papaver lapponicum has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes6

GenBank sequences8

eDNA detections24

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMG235031.1 ↗479 bpCanada · 2005

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCCAAGCCTTCGGGCCGAGGGCACGCTTGCCTGGGCGTCACGCACC …

Papaver lapponicum voucher CCDB-18332-G8 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★rbcLa★ITS2★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Papaver lapponicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records42–562n range42median42mode15records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 429×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +3

CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1980. Chromosome numbers and taxonomy of some species of the Anyui Mts. Bot. Zhurn. 65 (5): 651–659.

CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.

CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.

CCDB · book-ipcn67-71 — ZHUKOVA, P.G., & V.V. PETROVSKY. 1971. Chromosome numbers of certain flowering plants of the Wrangel island. (In Russian). Bot. Zurn. 56: 294-305.

CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976

CCDB · book-ipcn75-78 — Zhukova et al. 1977a

CCDB · book-ipcn73-74 — PACKER, J. G., & G.D. MCPHERSON. 1974. Chromosome numbers in some vascular plants from northern Alaska. Canad. J. Bot. 52: 1095-1099.

CCDB · eflora

CCDB · book-fedorov — Knaben 1959a, b

2n 566×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-northern-plants +3

CCDB · book-ipcn65 — Love 1962

CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.

CCDB · book-northern-plants — Horn 1938. Nygren (unpubl.).

CCDB · book-atlas-flowering-plants

CCDB · Cave1959 — Knaben 1959

CCDB · Cave1962 — Love 1962b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type809 records

Wild obs. + sensor279

Museum / vouchered530

Range

Area of Occupancy AOO1 860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 88≤1 km 37≤10 km 50>10 km 11

186 georeferenced · 93 without coordinates

Open the mapobservation + sensor279

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 15≤1 km 25≤10 km 56>10 km 10

106 georeferenced · 424 without coordinates

Open the institutions mapphysical evidence530

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	165
Olocation not on record	145
TROMlocation not on record	54
University of Alberta Museumslocation not on record	31
Bronx, US	20
University of Stellenboschlocation not on record	17
LDlocation not on record	15
Trondheim, NO	10
Yukon Universitylocation not on record	7
Oskarshamn, SE	6
Vancouver, CA	6
Anchorage, US	6
Stockholm, SE	5
Victoria, CA	5
St. Paul, US	4
Canadian Museum of Naturelocation not on record	4
Copenhagen, DK	4
NMBU:MINAlocation not on record	3
Whitehorse, CA	3
MeiseBGlocation not on record	2
Kandalaksha State Nature Reservelocation not on record	2
Montréal, CA	1
Chongqing Museumlocation not on record	1
Logan, US	1
Tromso University Museumlocation not on record	1
MAlocation not on record	1
KMNlocation not on record	1
Trois-Rivières, CA	1
Tampere, FI	1
Boise, US	1
Uppsala, SE	1
Flagstaff, US	1

32 institutions · 525 of 530 vouchered records shown · 5 without an institution code

09Environmental DNA24 detections

Where the DNA of Papaver lapponicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map4 countries0

Gravelly areas near the arctic coast.90% rock and lichen 50% n-facing slope, dry …Subhygric Herb-Moss Tundra, transitional to …Cushion Shrub (Salix polaris) - Moss Snowbank

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 3.20–11.3

Seasonal swing summer↔winter40.4 °C

Max temp (day)13.1 °C 5.70–16.2

Min temp (night)6.20 °C 1.60–7.10

Precipitation46.3 mm/mo 31.9–88.7

Air humidity59.8 % 57.6–68.1

Moisture balance-29.5 mm/mo

Vapour deficit488 Pa 239–573

Wind speed4.00 m/s

Cloud cover67.7 % 51.0–75.2

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)